WormBase Tree Display for Variation: WBVar00095116
expand all nodes | collapse all nodes | view schema
WBVar00095116 | Evidence | Paper_evidence | WBPaper00002585 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | p678 | |||||||
Other_name | CE27352:p.Gln82Ter | ||||||||
ZC84.2.1:c.244C>T | |||||||||
HGVSg | CHROMOSOME_III:g.9181987C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC84 | |||||
Flanking_sequences | aatgcagttcaaccagcggccaccggtggt | agccggcatcttccgatggcggttcagcta | |||||||
Mapping_target | ZC84 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002585 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00003905 | ||||||||
WBStrain00003907 | |||||||||
WBStrain00022726 | |||||||||
WBStrain00022727 | |||||||||
WBStrain00023534 | |||||||||
WBStrain00023536 | |||||||||
WBStrain00023537 | |||||||||
WBStrain00030785 | |||||||||
Laboratory | PR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006526 | |||||||
Transcript | ZC84.2.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC84.2.1:c.244C>T | ||||||||
HGVSp | CE27352:p.Gln82Ter | ||||||||
cDNA_position | 248 | ||||||||
CDS_position | 244 | ||||||||
Protein_position | 82 | ||||||||
Exon_number | 4/12 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000500199 | ||||||||
WBInteraction000501269 | |||||||||
WBInteraction000501491 | |||||||||
WBInteraction000501857 | |||||||||
WBInteraction000501960 | |||||||||
WBInteraction000501961 | |||||||||
WBInteraction000503645 | |||||||||
WBInteraction000520472 | |||||||||
WBInteraction000535467 | |||||||||
WBInteraction000535468 | |||||||||
WBInteraction000535469 | |||||||||
WBInteraction000535471 | |||||||||
WBInteraction000535472 | |||||||||
Genetics | Interpolated_map_position | III | 0.283998 | ||||||
Description | Phenotype | WBPhenotype:0000039 | Paper_evidence | WBPaper00032237 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The average lifespan was increased compared to control rrf-3(pk1426) animals. | Paper_evidence | WBPaper00032237 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00032237 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | rrf-3(pk1426) | Paper_evidence | WBPaper00032237 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00045085 | |||||||
WBPaper00060588 | |||||||||
Curator_confirmed | WBPerson21384 | ||||||||
WBPerson282 | |||||||||
Remark | The average lifespan was increased compared to wild-type animals. | Paper_evidence | WBPaper00045085 | ||||||
Curator_confirmed | WBPerson21384 | ||||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutations decreased overall levels of str-2 expression | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003760 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000154 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000254 | Paper_evidence | WBPaper00031959 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were completely defective in NaCl chemotaxis but not to NaAc in water soluble assays compared to wild-type. | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
repelled by Cl; athermotactic; reduced brood size | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00001360 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the water soluble chemotaxis assay, radial gradients of NaCl were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000295 | Paper_evidence | WBPaper00060588 | |||||||
Curator_confirmed | WBPerson282 | ||||||||
WBPhenotype:0000302 | Paper_evidence | WBPaper00041842 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The tax-4(p678) mutation resulted in defects in chemotaxis to benzaldehyde (Figure S1D) | Paper_evidence | WBPaper00041842 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002087 | Paper_evidence | WBPaper00041842 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00030973 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Ectopic expression of ASE fate in AFD via lim-6 reporter. No effect on gcy-7 and gcy-5 reporters | Paper_evidence | WBPaper00030973 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | 86 percent | Paper_evidence | WBPaper00030973 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00030973 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00030973 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00030973 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00030973 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | otIs6 [lim-6p::GFP], ntIs1[gcy-5p::GFP], otIs3 [ gcy-7p::GFP] | Paper_evidence | WBPaper00030973 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00042411 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure 9 | Paper_evidence | WBPaper00042411 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0043052 | PATO:0000460 | Paper_evidence | WBPaper00042411 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000481 | Paper_evidence | WBPaper00065019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Argentine ant extracts also repelled tax-4 mutants (tax-4: solvent vs Argentine ant extract, t(40) = 4.615, p = 0.002), | Paper_evidence | WBPaper00065019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Extracts of the Velvety tree ant showed a different pattern of behavioral response, in which tax-4 mutants were repelled by the extracts (tax-4: solvent vs Velvety tree ant extract, t(40) = 5.645, p < 0.001), but osm-9 mutants (osm-9: solvent vs Velvety tree ant extract, t(40) = 0.018, p = 0.985) and the wild type (PD1074: solvent vs Velvety tree ant extract, t(40) = 1.096, p = 0.373) were not. | Paper_evidence | WBPaper00065019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00008002 | Paper_evidence | WBPaper00065019 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00008001 | Paper_evidence | WBPaper00065019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00060588 | |||||||
Curator_confirmed | WBPerson282 | ||||||||
WBPhenotype:0000999 | Paper_evidence | WBPaper00035614 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | The tax-4 mutant presents an athermotactic response under all conditions tested | Paper_evidence | WBPaper00035614 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
athermotactic; reduced brood size | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001042 | Paper_evidence | WBPaper00031992 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All responses to NaCl upsteps and down-steps in ASEL and ASER were eliminated as imaged by calcium responses. | Paper_evidence | WBPaper00031992 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005663 | PATO:0000460 | Paper_evidence | WBPaper00031992 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | Calcium transients in ASE neurons were measured in response to NaCl concentration steps of 40mM from a baseline of 40 mM. | Paper_evidence | WBPaper00031992 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00031959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were completely defective in NaCl chemotaxis in water soluble assays. | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the water soluble chemotaxis assay, radial gradients of NaCl were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001234 | Paper_evidence | WBPaper00041842 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The tax-4(p678) mutation resulted in defects in chemotaxis to nonanone (Figure S1D) | Paper_evidence | WBPaper00041842 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00001711 | Paper_evidence | WBPaper00041842 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001273 | Paper_evidence | WBPaper00031874 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutations affecting the AFD or AIY neurons reduced heat shock-dependent accumulation of hsp70 (C12C8.1) mRNA at 30C and 34C | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to a transient increase in temperature (30C or 34C for 15 min), and their heat shock response was measured as the total amount of hsp70 (C12C8.1) mRNA, 2 hours after heat shock | Paper_evidence | WBPaper00031874 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001410 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No staining of activated MAP kinase was observed, even in after odorant stimulus, whereas immunoreactivity against the anti-activated-MAPK antibody was observed in the AWC neurons (and others) after 10 seconds of application with isoamylalcohol. | Paper_evidence | WBPaper00003955 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00003955 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001063 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001434 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | defective chemotaxis to Na, cAMP; repelled by Cl; athermotactic; reduced brood size | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004782 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00002962 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001435 | Paper_evidence | WBPaper00031959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed a reduction in chemotaxis to ammonium chloride compared to wild-type and were significantly defective in comparison to positive control che-1(p679) animals. | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002092 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the soluble assay, radial gradients of NH4Cl were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001438 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defective in chemotaxis to volatile odorants including benzaldehyde, 2-butanone and isoamyl alcohol (Data not shown). | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001442 | Paper_evidence | WBPaper00031959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed a reduction in chemotaxis to sodium acetate compared to wild-type animals but, animals still showed residual positive chemotaxis similar to che-1(p679). | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004924 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the soluble assay, radial gradients of NaAc were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001469 | Paper_evidence | WBPaper00032215 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited weak, if any, attraction to butanone. | Paper_evidence | WBPaper00032215 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005086 | Paper_evidence | WBPaper00032215 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001484 | Paper_evidence | WBPaper00041842 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The tax-4(p678) mutation resulted in defects in chemotaxis to ammonium acetate (Figure S1D) | Paper_evidence | WBPaper00041842 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002790 | Paper_evidence | WBPaper00041842 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutations sometimes resulted in 2 AWC OFF cells. Mutants occasionally expressed str-2 in both AWC neurons, but one neuron was usually much fainter than the other | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003760 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001692 | Paper_evidence | WBPaper00028386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ILD defective and suppressed CLD of srf-6; as assayed by the lack of staining by mAb M37 of L2 animals grown on plates containing crude pheromone. | Paper_evidence | WBPaper00028386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown synchronously from hatching to L2 on NGM plates containing crude pheromone extract. | Paper_evidence | WBPaper00028386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001738 | Paper_evidence | WBPaper00031959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were defective in ammonium chemotaxis in water soluble assays when compared to che-1(p679) positive control animals. | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002091 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the water soluble chemotaxis assay, radial gradients of NH4Cl were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001764 | Paper_evidence | WBPaper00037908 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | The carbon dioxide-evoked calcium transients of BAG neurons were eliminated. | Paper_evidence | WBPaper00037908 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031935 | |||||||
WBPaper00031936 | |||||||||
WBPaper00045598 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
Remark | Carbon dioxide avoidance (Cdad) was completely disrupted in the presence of food, but not in the absence of food. | Paper_evidence | WBPaper00031935 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Acute CO2 avoidance is eliminated | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Null mutants do not avoid high CO2. | Paper_evidence | WBPaper00045598 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003023 | Paper_evidence | WBPaper00045598 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Strains were maintained at 22C. Animals were exposed to a 5% to 0% CO2 gradient. | Paper_evidence | WBPaper00031935 | |||||
Curator_confirmed | WBPerson712 | ||||||||
10% CO2 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001790 | Paper_evidence | WBPaper00032060 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No change in AFD membrane potential was observed when animals were treated with temperature ramps. | Paper_evidence | WBPaper00032060 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00032060 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002014 | Paper_evidence | WBPaper00036207 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | GTP-gamma S stimulated inward current in ASJ was absent in the CNG channel mutants. Mastoparan elicited inward currents were blocked. | Paper_evidence | WBPaper00036207 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001587 | Paper_evidence | WBPaper00036207 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00004020 | Paper_evidence | WBPaper00036207 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002171 | Paper_evidence | WBPaper00042397 | |||||||
Curator_confirmed | WBPerson1928 | ||||||||
Remark | Animals are defective in chemotaxis towards attractive alkaline pH | Paper_evidence | WBPaper00042397 | ||||||
Curator_confirmed | WBPerson1928 | ||||||||
WBPhenotype:0002199 | Paper_evidence | WBPaper00049050 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The tax-4(p678) mutant, unlike wild type, exhibited no GCaMP3 signal (indicative of calcium concentration changes) in AFD neurons (in vivo or isolated in culture) in response to increasing temperature; "In addition, mutations in the molecular components essential for AFD thermosensation, GCY-8, GCY-18, and GCY-23 guanylyl cyclases, or the TAX-4 cGMP-gated cation channel (Inada et al., 2006; Komatsu et al., 1996), abolished thermal response of AFD in both cultured and in vivo conditions (Figure S1B; Table S1)." | Paper_evidence | WBPaper00049050 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00049050 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | njIs24[gcy-8p::GCaMP3, gcy-8p::TagRFP] (I); Parent strain: IK1154 | Paper_evidence | WBPaper00049050 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002638 | Paper_evidence | WBPaper00060871 | |||||||
Curator_confirmed | WBPerson53483 | ||||||||
Remark | Compromised response to oomycetes, specifically Myzocytiopsis humicola | Paper_evidence | WBPaper00060871 | ||||||
Curator_confirmed | WBPerson53483 | ||||||||
Phenotype_not_observed | WBPhenotype:0000012 | Paper_evidence | WBPaper00038115 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Less than 5% dauer at either 15 or 25 deg C. | Paper_evidence | WBPaper00038115 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001285 | Paper_evidence | WBPaper00045598 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants show a significant reduction in pumping following exposure to 10% CO2, similar to the reduction observed in wild-type (N2) animals | Paper_evidence | WBPaper00045598 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003023 | Paper_evidence | WBPaper00045598 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001474 | Paper_evidence | WBPaper00041842 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The tax-4(p678) mutation did not affect animals' chemotaxis response to pyrazine (Figure S1D) | Paper_evidence | WBPaper00041842 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00005360 | Paper_evidence | WBPaper00041842 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001616 | Paper_evidence | WBPaper00024698 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Trimethadione significantly extended life-span of mutant animals (N=52)(1 ind.exp.), as observed for WT animals. | Paper_evidence | WBPaper00024698 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Lifespan analysis was performed on animals exposed to 4 mg/ml of the drug from fertilization until death. Animals were cultured on NGM plates containing the drug and seeded with OP50. | Paper_evidence | WBPaper00024698 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20C | Paper_evidence | WBPaper00024698 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001690 | Paper_evidence | WBPaper00028386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown synchronously from hatching to L2 on NGM plates containing crude pheromone extract. | Paper_evidence | WBPaper00028386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001736 | Paper_evidence | WBPaper00031959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed no defect in acetate chemotaxis in water soluble assays when compared to che-1(p679) positive control animals. | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005057 | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For the water soluble chemotaxis assay, radial gradients of NaAc were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001897 | Paper_evidence | WBPaper00032087 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Loss-of-function mutations in the TAX-4 CNG channels do not affect the overall locomotion response to short wavelength light | Paper_evidence | WBPaper00032087 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032087 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00038115 | ||||||||
WBPaper00041842 | |||||||||
WBPaper00032237 | |||||||||
WBPaper00024698 | |||||||||
WBPaper00011986 | |||||||||
WBPaper00031936 | |||||||||
WBPaper00031935 | |||||||||
WBPaper00006052 | |||||||||
WBPaper00031874 | |||||||||
WBPaper00030973 | |||||||||
WBPaper00001786 | |||||||||
WBPaper00019249 | |||||||||
WBPaper00031959 | |||||||||
WBPaper00028386 | |||||||||
WBPaper00014724 | |||||||||
WBPaper00032087 | |||||||||
WBPaper00014951 | |||||||||
WBPaper00036207 | |||||||||
WBPaper00032215 | |||||||||
WBPaper00003760 | |||||||||
WBPaper00003955 | |||||||||
WBPaper00031992 | |||||||||
WBPaper00032060 | |||||||||
WBPaper00011929 | |||||||||
WBPaper00035614 | |||||||||
WBPaper00024095 | |||||||||
WBPaper00019210 | |||||||||
WBPaper00042411 | |||||||||
WBPaper00042397 | |||||||||
WBPaper00045085 | |||||||||
WBPaper00045598 | |||||||||
WBPaper00049050 | |||||||||
WBPaper00060871 | |||||||||
WBPaper00064927 | |||||||||
WBPaper00037908 | |||||||||
WBPaper00060588 | |||||||||
WBPaper00065019 | |||||||||
Remark | Corrected from pr678 appeared In 2002 European Worm Meeting abstract | Person_evidence | WBPerson712 | ||||||
Method | Substitution_allele |