WormBase Tree Display for Variation: WBVar00094781
expand all nodes | collapse all nodes | view schema
WBVar00094781 | Evidence | Person_evidence | WBPerson1705 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ot16 | |||||||
Other_name | CE36681:p.Gly610Glu | ||||||||
B0285.5.3:c.1829G>A | |||||||||
B0285.5.2:c.1829G>A | |||||||||
B0285.5.1:c.1829G>A | |||||||||
HGVSg | CHROMOSOME_III:g.4348971G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0285 | |||||
Flanking_sequences | ttgagtaaaacagcagatcgatggattggatacgcgtatg | aaaacgggcaaaacataattaattgttagtaagaaattt | |||||||
Mapping_target | B0285 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | OH | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002003 | |||||||
Transcript | B0285.5.1 (12) | ||||||||
B0285.5.3 (12) | |||||||||
B0285.5.2 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | B0285.5.2:c.1829G>A | ||||||||
HGVSp | CE36681:p.Gly610Glu | ||||||||
cDNA_position | 1837 | ||||||||
CDS_position | 1829 | ||||||||
Protein_position | 610 | ||||||||
Exon_number | 9/11 | ||||||||
Codon_change | gGa/gAa | ||||||||
Amino_acid_change | G/E | ||||||||
Interactor | WBInteraction000052327 | ||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | clonal F1 modifier screen | ||||||||
Genetics | Interpolated_map_position | III | -3.1845 | ||||||
Description | Phenotype | WBPhenotype:0000384 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defects in HSN axon morphology such that one HSN axon inappropriately projects contralaterally | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | mgIs71 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000541 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Roughly half of the commissures that make an incorrect midline choice reach the dorsal nerve cord | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000632 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Severe defasciculation defects | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001761 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Midline crossover defects of PVQL and PVQR axons, with either contralateral analog inappropriately crossing the midline | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006976 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oyIs14 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001767 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The midline choice (where the axons turn at the midline either to the left or right) is affected. | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Non-lethal | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No defects in HSN migration | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | mgIs71 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Non-sterile | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00006471 | ||||||||
Remark | The glycine residue that is changed is perfectly conserved and the mutation introduces a negative charge in the positively charged C-terminus. The C-terminus is indispensible for enzymatic activity | Person_evidence | WBPerson1705 | ||||||
Genotype is "mgIs18IV; otIs35X" | Person_evidence | WBPerson1705 | |||||||
Method | Substitution_allele |