WormBase Tree Display for Variation: WBVar00094754

WBVar00094754 Evidence: Paper_evidence: WBPaper00032405
  Name: Public_name: or749
    Other_name: or749ts
      K08E3.6.1:c.1342G>A
      CE18872:p.Glu448Lys
    HGVSg: CHROMOSOME_III:g.13769551C>T
  Sequence_details: SMap: S_parent: Sequence: K08E3
    Flanking_sequences: gcagcagttattcattgtgtggttgccctg aggctcgtggactcacgcaggaaggtattt
    Mapping_target: K08E3
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00032405
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00007362
      WBStrain00026734
    Laboratory: EU
    Status: Live
  Affects: Gene: WBGene00000875
    Transcript: K08E3.6.1 (12)
    Interactor (12)
  Isolation: Mutagen: ENU
  Genetics: Interpolated_map_position: III 21.5095
  Description: Phenotype_not_observed: WBPhenotype:0000812 Paper_evidence: WBPaper00061728
        Curator_confirmed: WBPerson557
        Remark: Authors found that the primordial germ line organization in cyk-4(or749ts) L1-stage larvae maintained at restrictive temperature (26C) for 12h was no different than control. Authors state these mutants are largely ineffective to perturb actomyosin function in the L1-stage primordial germ line. Paper_evidence: WBPaper00061728
            Curator_confirmed: WBPerson557
        EQ_annotations: Life_stage: WBls:0000024 PATO:0000460 Paper_evidence: WBPaper00061728
                Curator_confirmed: WBPerson557
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00061728
              Curator_confirmed: WBPerson557
        Phenotype_assay: Treatment: L1-stage larvae were upshifted at 26C for 12h, this is the restrictive temperature for these temperature-sensitive mutants. Paper_evidence: WBPaper00061728
              Curator_confirmed: WBPerson557
  Reference: WBPaper00032405
    WBPaper00045580
    WBPaper00061728
  Method: Substitution_allele