WormBase Tree Display for Variation: WBVar00092988
expand all nodes | collapse all nodes | view schema
WBVar00092988 | Name | Public_name | ok1789 | ||||
---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_II:g.9227070_9227361del | ||||||
Sequence_details | SMap | S_parent | Sequence | ZK1067 | |||
Flanking_sequences | aaaagtagtatttaaaaaagaaatttacct | gcgttcgaaacaactccttgaatcggagga | |||||
Mapping_target | ZK1067 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok1789_external | ||||||
ok1789_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00036519 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00004174 | |||||
Transcript | ZK1067.7.1 | VEP_consequence | splice_region_variant,coding_sequence_variant,5_prime_UTR_variant | ||||
VEP_impact | LOW | ||||||
cDNA_position | ?-145 | ||||||
CDS_position | ?-88 | ||||||
Protein_position | ?-30 | ||||||
Exon_number | 1-2/5 | ||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype | WBPhenotype:0000674 | Paper_evidence | WBPaper00045960 | |||
Curator_confirmed | WBPerson507 | ||||||
Remark | show slow development | Paper_evidence | WBPaper00045960 | ||||
Curator_confirmed | WBPerson507 | ||||||
WBPhenotype:0000709 | Paper_evidence | WBPaper00045960 | |||||
Curator_confirmed | WBPerson507 | ||||||
Remark | mutants have an abnormal pharyngeal cuticle | Paper_evidence | WBPaper00045960 | ||||
Curator_confirmed | WBPerson507 | ||||||
Reference | WBPaper00045960 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |