WormBase Tree Display for Variation: WBVar00092768
expand all nodes | collapse all nodes | view schema
WBVar00092768 | Evidence | Person_evidence | WBPerson353 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1558 | ||||||
Other_name | CE18701:p.Ser159Ter | |||||||
F47G4.3.1:c.474_774del | ||||||||
HGVSg | CHROMOSOME_I:g.14076408_14077634del | |||||||
Sequence_details | SMap | S_parent | Sequence | F47G4 | ||||
Flanking_sequences | agctgtgagaacggggagatcaagatgcaactgat | ctagaaaccaagaagtttgtggagcacttc | ||||||
Mapping_target | F47G4 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK1558_external | |||||||
OK1558_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032072 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
WBPerson353 | ||||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00009824 | ||||||
Transcript | F47G4.3.1 (11) | |||||||
Interactor | WBInteraction000500646 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Description | Phenotype_not_observed | WBPhenotype:0001710 | Paper_evidence | WBPaper00032037 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Diurnal variation of osmotic stress tolerance does not differ from control (TJ1060) animals. Data not shown. | Paper_evidence | WBPaper00032037 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were maintained at 16C under 12:12 h light:dark conditions. For testing, synchronized cultures of L1 larva were maintained without food for 3 days and entrained to LD conditions. Worms were fed with E.coli and kept at a final concentration of 15 worms/10ul at 25C. 50uM fluorodeoxyuridine (FuDR) was added when worms were L4. | Paper_evidence | WBPaper00032037 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032037 | |||||||
Remark | Allele sequenced by Todd Lamitina | Curator_confirmed | WBPerson2970 | |||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |