WormBase Tree Display for Variation: WBVar00092700
expand all nodes | collapse all nodes | view schema
WBVar00092700 | Evidence | Paper_evidence | WBPaper00033444 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1489 | ||||||
Other_name | C55B7.4b.1:c.162_667del | |||||||
C55B7.4b.2:c.162_667del | ||||||||
CE32840:p.Glu55ThrfsTer3 | ||||||||
C55B7.4a.1:c.441_946del | ||||||||
CE09015:p.Glu148ThrfsTer3 | ||||||||
HGVSg | CHROMOSOME_I:g.6498246_6498845del | |||||||
Sequence_details | SMap | S_parent | Sequence | C55B7 | ||||
Flanking_sequences | tgtatcaatgattatagattatggaacaga | gacttattgattttcaggttatttttgaaa | ||||||
Mapping_target | C55B7 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok1489_external | |||||||
ok1489_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00036246 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00016943 | ||||||
Transcript | C55B7.4b.1 (11) | |||||||
C55B7.4a.1 (11) | ||||||||
C55B7.4b.2 (11) | ||||||||
Interactor | WBInteraction000566982 | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00049812 | ||||
Curator_confirmed | WBPerson1997 | |||||||
Remark | on very low vitamin B12 diets (Figure 2C) | Paper_evidence | WBPaper00049812 | |||||
Curator_confirmed | WBPerson1997 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00049812 | |||||
Curator_confirmed | WBPerson1997 | |||||||
Recessive | Paper_evidence | WBPaper00049812 | ||||||
Curator_confirmed | WBPerson1997 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00049812 | ||||
Curator_confirmed | WBPerson1997 | |||||||
Treatment | Worms fed a diet very low in vitamin B12 | Paper_evidence | WBPaper00049812 | |||||
Curator_confirmed | WBPerson1997 | |||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00059839 | ||||||
Curator_confirmed | WBPerson42723 | |||||||
Remark | extended lifespan upon exposure to S. maltophilia JV3 | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | On a Comamonas DA1877 diet, acdh-1(ok1489) animals exhibited increased mRNA levels of endogenous acdh-2, nhr-68, and cth-1 | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | |||||||
On an E. coli OP50 diet, acdh-1(ok1489) animals exhibited increased mRNA levels of endogenous acdh-2, ech-6, F09F7.4 and cth-1 | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Worms fed on a Comamonas DA1877 diet | Paper_evidence | WBPaper00042204 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Worms fed on a E. coli OP50 diet | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutant strains showed minor differences in absolute fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00033444 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00059839 | ||||||
Curator_confirmed | WBPerson42723 | |||||||
Remark | shortened lifespan upon exposure to E. coli OP50, S. maltophilia K279a and JCMS | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Interestingly, acdh-1 itself was found as a repressor in the RNAi screen (Table S2). We obtained an acdh-1 deletion mutant and introduced it into the Pacdh-1::GFP dietary sensor strain. We observed higher GFP levels in the acdh-1 mutant relative to the wild-type dietary sensor strain when the animals were fed E. Coli OP50 or HT115 diets but observed less of an increase on a Comamonas DA1877 diet." (Figure 4A) | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | Pacdh-1::GFP | Paper_evidence | WBPaper00042204 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001918 | Paper_evidence | WBPaper00044854 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We tested the sensitivity of Dacdh-1 mutants to propionic acid and found that they are much more sensitive than wild-type animals (Figure 6B). Unlike Dpcca-1 mutants, however, Dacdh-1 mutants survived better on propionic acid when vitamin B12 was supplemented to the diet." | Paper_evidence | WBPaper00044854 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004332 | Paper_evidence | WBPaper00044854 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000679 | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "To determine whether known nutrient sensing pathways such as TOR or the insulin signaling pathway are involved in upregulating acdh-1 in response to metabolic network perturbations, we performed RNAi on a panel of genes from these pathways in metabolic mutants harboring the Pacdh-1::GFP transgene. Knockdown of daf-2 or daf-16 had no effect on GFP expression in any of the mutants (Figure 6A). We also crossed the Dmetr-1 and Dacdh-1 metabolic mutations into a transgenic strain expressing a DAF-16::GFP fusion protein to determine whether these metabolic mutants affected DAF-16 nuclear localization and found that neither had any effect (data not shown)." | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | DAF-16::GFP | Paper_evidence | WBPaper00042204 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00042204 | |||||||
WBPaper00033444 | ||||||||
WBPaper00044854 | ||||||||
WBPaper00049812 | ||||||||
WBPaper00059839 | ||||||||
WBPaper00065272 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |