WormBase Tree Display for Variation: WBVar00092632
expand all nodes | collapse all nodes | view schema
WBVar00092632 | Name | Public_name | ok1417 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C14B1.4.1:c.292_940del | |||||||
CE00901:p.Cys98AsnfsTer22 | ||||||||
HGVSg | CHROMOSOME_III:g.3705641_3706335del | |||||||
Sequence_details | SMap | S_parent | Sequence | C14B1 | ||||
Flanking_sequences | aaaatcgatttcttcagctaaattttcccca | aatggatcatcagtggttccgaagattgta | ||||||
Mapping_target | C14B1 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK1417_external | |||||||
OK1417_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000041 | |||||||
WBStrain00032003 | ||||||||
WBStrain00056267 | ||||||||
Laboratory | RB | |||||||
ZAS | ||||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006474 | ||||||
Transcript | C14B1.4.1 (11) | |||||||
Interactor | WBInteraction000519739 | |||||||
WBInteraction000519740 | ||||||||
WBInteraction000521442 | ||||||||
WBInteraction000521443 | ||||||||
Description | Phenotype | WBPhenotype:0000030 | Paper_evidence | WBPaper00032309 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals did not show any obvious developmental defects at 15C however animals took longer to reach adulthood at 25C. | Paper_evidence | WBPaper00032309 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00032309 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00038409 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The wdr-5 mutant produces 45% embryonic lethality at 25 deg C. | Paper_evidence | WBPaper00038409 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00038409 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00036383 | ||||||
WBPaper00058938 | ||||||||
WBPaper00060474 | ||||||||
Curator_confirmed | WBPerson11446 | |||||||
WBPerson8962 | ||||||||
WBPerson8633 | ||||||||
Remark | Figure 1, homozygous mutant populations acquire longevity only after multiple generations post-thaw or after homozygosing | Paper_evidence | WBPaper00058938 | |||||
Curator_confirmed | WBPerson8962 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00038409 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Average brood size 44 at 20 deg C, 19 at 25 deg C. | Paper_evidence | WBPaper00038409 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00038409 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000275 | Paper_evidence | WBPaper00060474 | ||||||
Curator_confirmed | WBPerson8633 | |||||||
Remark | Figure 1, larval arrest and lifespan shortening were observed upon UV treatment. | Paper_evidence | WBPaper00060474 | |||||
Curator_confirmed | WBPerson8633 | |||||||
WBPhenotype:0000743 | Paper_evidence | WBPaper00032309 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed less severe RNAi-induced phenotypes than wild-type for five out of seven genes tested. | Paper_evidence | WBPaper00032309 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | L4 animals were submitted to different RNAi feeding experiments at 20C. | Paper_evidence | WBPaper00032309 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 20 | Paper_evidence | WBPaper00032309 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000966 | Paper_evidence | WBPaper00032309 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited late onset sterility, occurring between generation F3 and F4. Animals also exhibited late-onset embryonic lethality, Him and additional somatic defects. | Paper_evidence | WBPaper00032309 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20, 25 | Paper_evidence | WBPaper00032309 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001383 | Paper_evidence | WBPaper00032309 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Di- and trimethylation levels were found to be significantly decreased. | Paper_evidence | WBPaper00032309 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Global levels of histone H3 K4 methylation were tested on total extracts prepared from synchronized adult populations by using antibodies directed against di- or trimethylated H3K4. | Paper_evidence | WBPaper00032309 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002078 | Paper_evidence | WBPaper00038409 | ||||||
WBPaper00036383 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson11446 | ||||||||
Remark | At the two-cell stage, H3K4me3 deposition was detected, though the signal appeared weaker than in wild type worms. At four-cell stage, the H3K4me3 mark was unable to be detected No defect in levels of deposition of H3K27me2 or of H3K27me3. At the eight-cell stage, as well as at post-gastrulation, the H3K4me3 mark is undetectable in wdr-5, mutants compared to N2. H3K4me3 is undetectable in Western blot analysis. | In wdr-5 gonads, the H3K4me3 mark is detectable, but its deposition pattern has changed compared to controls; the zone normally low in H3K4me3 levels is extended in wdr-5 mutants. | Paper_evidence | WBPaper00038409 | |||||
Curator_confirmed | WBPerson712 | |||||||
These worms have lower global levels of H3K4me3 | Paper_evidence | WBPaper00036383 | ||||||
Curator_confirmed | WBPerson11446 | |||||||
WBPhenotype:0002167 | Paper_evidence | WBPaper00058938 | ||||||
Curator_confirmed | WBPerson8962 | |||||||
Remark | Figure 3, determined by H3K9me2 ChIP-seq | Paper_evidence | WBPaper00058938 | |||||
Curator_confirmed | WBPerson8962 | |||||||
Reference | WBPaper00038409 | |||||||
WBPaper00036383 | ||||||||
WBPaper00032309 | ||||||||
WBPaper00058938 | ||||||||
WBPaper00060474 | ||||||||
WBPaper00065754 | ||||||||
Remark | ok1417 has a 695-bp deletion starting at position 354 and ending at position 1050 within the coding sequence. | Person_evidence | WBPerson467 | |||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |