WormBase Tree Display for Variation: WBVar00092007
expand all nodes | collapse all nodes | view schema
WBVar00092007 | Evidence | Paper_evidence | WBPaper00033002 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok725 | |||||||
Other_name (15) | |||||||||
HGVSg | CHROMOSOME_X:g.13869540_13870374del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T21H8 | |||||
Flanking_sequences | agtggagaatgcatgaaaatcttcctaaaa | acctataacaaaccataatataattttttt | |||||||
Mapping_target | T21H8 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok725_external | ||||||||
ok725_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031591 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00011904 | |||||||
Transcript | T21H8.1m.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1m.1:c.168_420+208del | ||||||||
cDNA_position | 168-? | ||||||||
CDS_position | 168-? | ||||||||
Protein_position | 56-? | ||||||||
Intron_number | 3-4/12 | ||||||||
Exon_number | 3-4/13 | ||||||||
T21H8.1l.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1l.1:c.429_681+208del | ||||||||
cDNA_position | 429-? | ||||||||
CDS_position | 429-? | ||||||||
Protein_position | 143-? | ||||||||
Intron_number | 5-6/14 | ||||||||
Exon_number | 5-6/15 | ||||||||
T21H8.1k.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1k.2:c.429_681+208del | ||||||||
cDNA_position | 555-? | ||||||||
CDS_position | 429-? | ||||||||
Protein_position | 143-? | ||||||||
Intron_number | 6-7/16 | ||||||||
Exon_number | 6-7/17 | ||||||||
T21H8.1k.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1k.1:c.429_681+208del | ||||||||
cDNA_position | 639-? | ||||||||
CDS_position | 429-? | ||||||||
Protein_position | 143-? | ||||||||
Intron_number | 7-8/16 | ||||||||
Exon_number | 7-8/17 | ||||||||
T21H8.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1a.1:c.579_831+208del | ||||||||
cDNA_position | 587-? | ||||||||
CDS_position | 579-? | ||||||||
Protein_position | 193-? | ||||||||
Intron_number | 5-6/15 | ||||||||
Exon_number | 5-6/16 | ||||||||
T21H8.1d.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1d.1:c.579_691-436del | ||||||||
cDNA_position | 579-? | ||||||||
CDS_position | 579-? | ||||||||
Protein_position | 193-? | ||||||||
Intron_number | 4/13 | ||||||||
Exon_number | 4/14 | ||||||||
T21H8.1h.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1h.1:c.705_957+208del | ||||||||
cDNA_position | 705-? | ||||||||
CDS_position | 705-? | ||||||||
Protein_position | 235-? | ||||||||
Intron_number | 7-8/17 | ||||||||
Exon_number | 7-8/18 | ||||||||
T21H8.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1b.1:c.579_831+208del | ||||||||
cDNA_position | 579-? | ||||||||
CDS_position | 579-? | ||||||||
Protein_position | 193-? | ||||||||
Intron_number | 4-5/14 | ||||||||
Exon_number | 4-5/15 | ||||||||
T21H8.1c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1c.1:c.579_691-436del | ||||||||
cDNA_position | 579-? | ||||||||
CDS_position | 579-? | ||||||||
Protein_position | 193-? | ||||||||
Intron_number | 4/12 | ||||||||
Exon_number | 4/13 | ||||||||
T21H8.1i.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1i.1:c.627_879+208del | ||||||||
cDNA_position | 633-? | ||||||||
CDS_position | 627-? | ||||||||
Protein_position | 209-? | ||||||||
Intron_number | 7-8/17 | ||||||||
Exon_number | 7-8/18 | ||||||||
T21H8.1n.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1n.1:c.168_420+208del | ||||||||
cDNA_position | 168-? | ||||||||
CDS_position | 168-? | ||||||||
Protein_position | 56-? | ||||||||
Intron_number | 3-4/12 | ||||||||
Exon_number | 3-4/13 | ||||||||
T21H8.1s.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1s.1:c.132_384+208del | ||||||||
cDNA_position | 132-? | ||||||||
CDS_position | 132-? | ||||||||
Protein_position | 44-? | ||||||||
Intron_number | 3-4/12 | ||||||||
Exon_number | 3-4/13 | ||||||||
T21H8.1r.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1r.1:c.132_384+208del | ||||||||
cDNA_position | 132-? | ||||||||
CDS_position | 132-? | ||||||||
Protein_position | 44-? | ||||||||
Intron_number | 3-4/12 | ||||||||
Exon_number | 3-4/13 | ||||||||
T21H8.1j.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1j.1:c.627_879+208del | ||||||||
cDNA_position | 627-? | ||||||||
CDS_position | 627-? | ||||||||
Protein_position | 209-? | ||||||||
Intron_number | 6-7/16 | ||||||||
Exon_number | 6-7/17 | ||||||||
T21H8.1g.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T21H8.1g.1:c.705_957+208del | ||||||||
cDNA_position | 751-? | ||||||||
CDS_position | 705-? | ||||||||
Protein_position | 235-? | ||||||||
Intron_number | 8-9/18 | ||||||||
Exon_number | 8-9/19 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype (10) | ||||||||
Phenotype_not_observed | WBPhenotype:0000114 | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | RNA blot results indicated no difference in unc-10 or syd-2 mRNA levels between wild-type and hlb-1(ok725) animals | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | RNA blot analysis | Paper_evidence | WBPaper00033002 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No thermotaxis defects | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000604 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The GABA nervous system in hlb-1(ok725) adult animals was indistinguishable from that in wild-type | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00033002 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00033002 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | hlb-1 mutants did not show obvious chemotaxis defects to NaCl | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Axons could extend along both the ventral and dorsal nerve cords of GABA nervous system and were stably maintained in hlb-1(ok725) adults | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00033002 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001323 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No obvious changes in the expression of panneural vesicle marker synaptogyrin-GFP (jsIs219) were observed in hlb-1(ok725) mutants, compared to wild-type | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | synaptogyrin-GFP (jsIs219) | Paper_evidence | WBPaper00033002 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001331 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | GABAergic inhibitory motor neurons appeared normal | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001441 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | hlb-1 mutants did not show obvious chemotaxis defects to biotin | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001526 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In hlb-1(ok725) mutant animals, the axons of AFD sensory neurons terminated at the proper position, as observed in wild-type. The sensory ending of AFD neurons in hlb-1(ok725) mutant animals was also normal | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001565 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | hlb-1 mutants did not show obvious chemotaxis defects to lysine | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00033002 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |