WormBase Tree Display for Variation: WBVar00092007
expand all nodes | collapse all nodes | view schema
WBVar00092007 | Evidence | Paper_evidence | WBPaper00033002 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok725 | |||||||
Other_name | T21H8.1g.1:c.705_957+208del | ||||||||
T21H8.1r.1:c.132_384+208del | |||||||||
T21H8.1j.1:c.627_879+208del | |||||||||
T21H8.1c.1:c.579_691-436del | |||||||||
T21H8.1d.1:c.579_691-436del | |||||||||
T21H8.1l.1:c.429_681+208del | |||||||||
T21H8.1a.1:c.579_831+208del | |||||||||
T21H8.1m.1:c.168_420+208del | |||||||||
T21H8.1k.2:c.429_681+208del | |||||||||
T21H8.1i.1:c.627_879+208del | |||||||||
T21H8.1n.1:c.168_420+208del | |||||||||
T21H8.1k.1:c.429_681+208del | |||||||||
T21H8.1b.1:c.579_831+208del | |||||||||
T21H8.1s.1:c.132_384+208del | |||||||||
T21H8.1h.1:c.705_957+208del | |||||||||
HGVSg | CHROMOSOME_X:g.13869540_13870374del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T21H8 | |||||
Flanking_sequences | agtggagaatgcatgaaaatcttcctaaaa | acctataacaaaccataatataattttttt | |||||||
Mapping_target | T21H8 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok725_external | ||||||||
ok725_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031591 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00011904 | |||||||
Transcript (15) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00033002 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Compared to wild-type, hlb-1 (ok725) animals were highly resistant to aldicarb | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00033002 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000019 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Reduced pumping rate in old adults | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000069 | PATO:0000460 | Paper_evidence | WBPaper00033002 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Reduced brood size | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00033002 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000273 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Noticeable decrease in thrashing frequency for both the L1 larvae and adult nematodes compared to wild-type | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage (2) | ||||||||
WBPhenotype:0000421 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Compared to wild-type, hlb-1 (ok725) animals were highly resistant to levamisole | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00033002 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Abnormal SNB-1::GFP puncta in the hlb-1(ok725) mutants, which appeared slightly diffused and more widely spaced than normal, along with a decrease in the number of puncta in both ventral and dorsal cords | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | Punc-25-SNB-1::GFP (juIs1) | Paper_evidence | WBPaper00033002 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001005 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals exhibit a mild backing phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001321 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The area of the presynaptic zone in hlb-1(ok725) was significantly enlarged compared to that in wild-type animals. Active zone morphology appears normal | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | UNC-10 immunohistochemistry assay | Paper_evidence | WBPaper00033002 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001482 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Reduced body bends per time interval | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage (2) | ||||||||
WBPhenotype:0001685 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In hlb-1(ok725) mutants, the puncta appeared enlarged, diffused, and spaced farther apart than normal. The area of the postsynaptic zone in hlb-1(ok725) was also significantly enlarged compared to that in wild-type animals | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs22 (UNC-49::GFP) | Paper_evidence | WBPaper00033002 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000114 | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | RNA blot results indicated no difference in unc-10 or syd-2 mRNA levels between wild-type and hlb-1(ok725) animals | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | RNA blot analysis | Paper_evidence | WBPaper00033002 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No thermotaxis defects | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000604 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The GABA nervous system in hlb-1(ok725) adult animals was indistinguishable from that in wild-type | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00033002 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00033002 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | hlb-1 mutants did not show obvious chemotaxis defects to NaCl | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Axons could extend along both the ventral and dorsal nerve cords of GABA nervous system and were stably maintained in hlb-1(ok725) adults | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00033002 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001323 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No obvious changes in the expression of panneural vesicle marker synaptogyrin-GFP (jsIs219) were observed in hlb-1(ok725) mutants, compared to wild-type | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | synaptogyrin-GFP (jsIs219) | Paper_evidence | WBPaper00033002 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001331 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | GABAergic inhibitory motor neurons appeared normal | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001441 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | hlb-1 mutants did not show obvious chemotaxis defects to biotin | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001526 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In hlb-1(ok725) mutant animals, the axons of AFD sensory neurons terminated at the proper position, as observed in wild-type. The sensory ending of AFD neurons in hlb-1(ok725) mutant animals was also normal | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001565 | Paper_evidence | WBPaper00033002 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | hlb-1 mutants did not show obvious chemotaxis defects to lysine | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033002 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00033002 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |