WormBase Tree Display for Variation: WBVar00091881
expand all nodes | collapse all nodes | view schema
WBVar00091881 | Name | Public_name | ok595 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C34F6.4.1:c.350+11_764del | ||||||||
HGVSg | CHROMOSOME_X:g.11205292_11206626del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C34F6 | |||||
Flanking_sequences | tttggtgggatctttttctttgtgtatcgt | gaatattgaccgttgaaaatcgataaatgc | |||||||
Mapping_target | C34F6 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK595_external | ||||||||
OK595_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00029327 | ||||||||
WBStrain00031513 | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002029 | |||||||
Transcript | C34F6.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C34F6.4.1:c.350+11_764del | ||||||||
cDNA_position | ?-831 | ||||||||
CDS_position | ?-764 | ||||||||
Protein_position | ?-255 | ||||||||
Intron_number | 4-7/9 | ||||||||
Exon_number | 5-8/10 | ||||||||
Interactor | WBInteraction000524035 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4421 | ||||||
Description | Phenotype | WBPhenotype:0000229 | Paper_evidence | WBPaper00029002 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defects in HSN axon morphology such that one HSN axon inappropriately projects contralaterally | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | mgIs71 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Loss of hst-2 disrupts HSN cell migration | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | mgIs71 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000541 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Roughly half of the commissures that make an incorrect midline choice reach the dorsal nerve cord | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000632 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Severe defasciculation defects | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001761 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Midline crossover defects of PVQL and PVQR as well as PVPL and PVPR axons, with either contralateral analog inappropriately crossing the midline | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006976 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0006832 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oyIs14, hdIs26 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001767 | Paper_evidence | WBPaper00006471 | |||||||
WBPaper00032413 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The midline choice (where the axons turn at the midline either to the left or right) is affected. | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Removal of 2O-sulfation results in mild defects in the sidedness of motor axon projections. These mild defects show cell-type specificity, with DA2, DB3, DB6, and DB7 being most affected by loss of 2O-sulfation | Paper_evidence | WBPaper00032413 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
WBPaper00032413 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0004869 | PATO:0000460 | Paper_evidence | WBPaper00032413 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0004844 | PATO:0000460 | Paper_evidence | WBPaper00032413 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0004841 | PATO:0000460 | Paper_evidence | WBPaper00032413 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000012 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Not daf-c | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00040941 | |||||||
Curator_confirmed | WBPerson1705 | ||||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Non-lethal | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000245 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No defects in SM migration | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000604 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The nervous system is grossly intact in all mutants | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term (13) | ||||||||
Phenotype_assay | Treatment | DiI staining | Paper_evidence | WBPaper00006471 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | oyIs17, otEx404, mgIs18, uIs25, otEx1043, zdIs5, otEx1082, otIs39, evIs82b, wdIs3 | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Non-Unc | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00006471 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Non-sterile | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00006471 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00040941 | ||||||||
WBPaper00032413 | |||||||||
WBPaper00029002 | |||||||||
WBPaper00006471 | |||||||||
WBPaper00024916 | |||||||||
WBPaper00019290 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |