WormBase Tree Display for Variation: WBVar00091799
expand all nodes | collapse all nodes | view schema
WBVar00091799 | Name | Public_name | ok512 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | Y22D7AR.13.1:c.643-705_900+373del | ||||||||
HGVSg | CHROMOSOME_III:g.1725264_1726599del | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y22D7AR | |||||
Flanking_sequences | tgtatatacatttgaatttttgtagaaaaa | aatataattttccaaaaatgaacaagtttc | |||||||
Mapping_target | Y22D7AR | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product (2) | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000209 | ||||||||
WBStrain00031461 | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004779 | |||||||
Transcript | Y22D7AR.13.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y22D7AR.13.1:c.643-705_900+373del | ||||||||
Intron_number | 5-6/9 | ||||||||
Exon_number | 6/10 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4656 | ||||||
Description | Phenotype (20) | ||||||||
Phenotype_not_observed | WBPhenotype:0000631 | Paper_evidence | WBPaper00036766 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Sensitivity to fluoxetine-induced paralysis was not significantly changed in mutants. | Paper_evidence | WBPaper00036766 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005058 | Paper_evidence | WBPaper00036766 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000844 | Paper_evidence | WBPaper00031915 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants were susceptible to the increased pumping rates of exogenously administered serotonin | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 5mM serotonin | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 22C | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00032196 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were as susceptible to infection by P. aeruginosa as N2 animals. | Paper_evidence | WBPaper00032196 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Strain | WBStrain00000209 | Paper_evidence | WBPaper00032196 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001068 | Paper_evidence | WBPaper00031241 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Pre-exposure to mianserin blocked serotonin-induced egg laying as it does for N2 animals. | Paper_evidence | WBPaper00031241 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00031241 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were pre-exposed to 50uM mianserin. | Paper_evidence | WBPaper00031241 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001101 | Paper_evidence | WBPaper00038382 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No effects on clozapine-induced egg laying were observed. | Paper_evidence | WBPaper00038382 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003634 | Paper_evidence | WBPaper00038382 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001444 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited similar gustatory plasticity of NaCl to wild type (data not shown). | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl after various pre-treatments: a 15-min wash in CTX buffer with or without 100 mM NaCl (liquid), or 30 min on a CTX plate with or without 100 mM NaCl, and in the presence or absence of bacteria, 500 mM glycerol, or 3 uL of benzaldehyde. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001811 | Paper_evidence | WBPaper00031915 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants were susceptible to the fat-reducing effects of exogenously administered serotonin | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Reduced fat content of 5-HT-treated animals was visualized by Nile red staining and confirmed by thin-layer chromatography (TLC) quantitation of total triglycerides extracted from vehicle- and 5-HT-treated worms and by Sudan black fat staining | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001842 | Paper_evidence | WBPaper00033168 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Significant rebound response in ser-4 animals | Paper_evidence | WBPaper00033168 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | trifluoperazine (40 uM) | Paper_evidence | WBPaper00033168 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (11) | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |