WormBase Tree Display for Variation: WBVar00091672
expand all nodes | collapse all nodes | view schema
| WBVar00091672 | Name | Public_name | ok375 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | C05C12.3.1:c.2341_4189+57delinsGAAAGAAGAAAAGAAAAGAGAATGAAGTTTCAGTGAAGAAAGGAAGACGC | ||||||
| HGVSg | CHROMOSOME_IV:g.11250567_11253279delinsGCGTCTTCCTTTCTTCACTGAAACTTCATTCTCTTTTCTTTTCTTCTTTC | ||||||
| Sequence_details | SMap | S_parent | Sequence | C05C12 | |||
| Flanking_sequences | ataacattttcatttggtcgaggagggcct | ttcactgaaactcttttcaatacaagttgg | |||||
| Mapping_target | C05C12 | ||||||
| Type_of_mutation | Insertion | gcgtcttcctttcttcactgaaacttcattctcttttcttttcttctttc | |||||
| Deletion | |||||||
| PCR_product | OK375_external | ||||||
| OK375_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00035612 | ||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001795 | |||||
| Transcript | C05C12.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | C05C12.3.1:c.2341_4189+57delinsGAAAGAAGAAAAGAAAAGAGAATGAAGTTTCAGTGAAGAAAGGAAGACGC | ||||||
| cDNA_position | 2411-? | ||||||
| CDS_position | 2341-? | ||||||
| Protein_position | 781-? | ||||||
| Intron_number | 18-26/33 | ||||||
| Exon_number | 18-26/34 | ||||||
| Interactor | WBInteraction000050597 | ||||||
| WBInteraction000050598 | |||||||
| WBInteraction000501215 | |||||||
| Genetics | Mapping_data | In_multi_point | 4386 | ||||
| Description | Phenotype_not_observed | WBPhenotype:0000207 | Paper_evidence | WBPaper00031896 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Mean cycle time appears normal. | Paper_evidence | WBPaper00031896 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000246 | Paper_evidence | WBPaper00031896 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Variation between cycle onset times appears normal. | Paper_evidence | WBPaper00031896 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001273 | Paper_evidence | WBPaper00038142 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Using a thermal barrier assay to test heat avoidance, no defect in heat avoidance was observed. | Paper_evidence | WBPaper00038142 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00038142 | ||||||
| WBPaper00031896 | |||||||
| WBPaper00025331 | |||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
