WormBase Tree Display for Variation: WBVar00091540
expand all nodes | collapse all nodes | view schema
WBVar00091540 | Name | Public_name | ok237 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_X:g.4710347_4712575del | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_X | ||||
Flanking_sequences | ttttgagaaggcggtggaggcatggcaatc | ttcgctaaaaaattgagccaatttattatt | ||||||
Mapping_target | CHROMOSOME_X | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok237_external | |||||||
ok237_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00033400 | |||||||
WBStrain00037702 | ||||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018878 | ||||||
WBGene00200170 | ||||||||
WBGene00001032 | ||||||||
WBGene00199202 | ||||||||
Transcript | K02G10.8b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-615 | |||||||
CDS_position | ?-611 | |||||||
Protein_position | ?-204 | |||||||
Intron_number | 2/4 | |||||||
Exon_number | 1-3/5 | |||||||
DL2.2 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
F55D10.3.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2/5 | |||||||
Exon_number | 1-2/6 | |||||||
K02G10.8a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-621 | |||||||
CDS_position | ?-611 | |||||||
Protein_position | ?-204 | |||||||
Intron_number | 2/4 | |||||||
Exon_number | 1-3/5 | |||||||
DL2.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 4264 | |||||
Description | Phenotype | WBPhenotype:0000273 | Paper_evidence | WBPaper00045410 | ||||
Curator_confirmed | WBPerson8908 | |||||||
Remark | Very small, but significant, reduction in thrashing assays | Paper_evidence | WBPaper00045410 | |||||
Curator_confirmed | WBPerson8908 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00045410 | ||||||
WBPaper00048929 | ||||||||
Curator_confirmed | WBPerson8908 | |||||||
Remark | reduced lifespan | Paper_evidence | WBPaper00045410 | |||||
Curator_confirmed | WBPerson8908 | |||||||
reduced lifespan rescued by a drug (ethosuximide) | Paper_evidence | WBPaper00048929 | ||||||
Curator_confirmed | WBPerson8908 | |||||||
Affected_by | Molecule | WBMol:00003963 | Paper_evidence | WBPaper00048929 | ||||
Curator_confirmed | WBPerson8908 | |||||||
WBPhenotype:0001398 | Paper_evidence | WBPaper00045410 | ||||||
Curator_confirmed | WBPerson8908 | |||||||
Remark | Age-dependent loss of neurites and variations in the structure of neurites and cell bodies of unidentified sensory neurons in the head | Paper_evidence | WBPaper00045410 | |||||
Curator_confirmed | WBPerson8908 | |||||||
WBPhenotype:0001434 | Paper_evidence | WBPaper00045410 | ||||||
WBPaper00048929 | ||||||||
Curator_confirmed | WBPerson8908 | |||||||
Remark | Age-dependent reduction in chemotaxis toward chemoattractants and food sources | Paper_evidence | WBPaper00045410 | |||||
Curator_confirmed | WBPerson8908 | |||||||
reduced chemotaxis rescued by a drug (ethosuximide) | Paper_evidence | WBPaper00048929 | ||||||
Curator_confirmed | WBPerson8908 | |||||||
Affected_by | Molecule | WBMol:00003963 | Paper_evidence | WBPaper00048929 | ||||
Curator_confirmed | WBPerson8908 | |||||||
WBPhenotype:0001620 | Paper_evidence | WBPaper00053621 | ||||||
Curator_confirmed | WBPerson28450 | |||||||
Recessive | Paper_evidence | WBPaper00053621 | ||||||
Curator_confirmed | WBPerson28450 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00053621 | |||||
Curator_confirmed | WBPerson28450 | |||||||
WBPhenotype:0001621 | Paper_evidence | WBPaper00053621 | ||||||
Curator_confirmed | WBPerson28450 | |||||||
Recessive | Paper_evidence | WBPaper00053621 | ||||||
Curator_confirmed | WBPerson28450 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00053621 | |||||
Curator_confirmed | WBPerson28450 | |||||||
Disease_info | Models_disease | DOID:14330 | ||||||
DOID:14503 | ||||||||
Models_disease_in_annotation | WBDOannot00000331 | |||||||
WBDOannot00000637 | ||||||||
Reference | WBPaper00045410 | |||||||
WBPaper00048929 | ||||||||
WBPaper00053621 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |