WormBase Tree Display for Variation: WBVar00091517
expand all nodes | collapse all nodes | view schema
| WBVar00091517 | Name | Public_name | ok210 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_I:g.12105617_12106595delinsG | ||||||||
| Sequence_details | SMap | S_parent | Sequence | M01G12 | |||||
| Flanking_sequences | attttcaacgaaagtttttcggttatttca | agaggaaaaaatacggacaagaagaataat | |||||||
| Mapping_target | M01G12 | ||||||||
| Type_of_mutation | Insertion | G | |||||||
| Deletion | |||||||||
| PCR_product | ok210_external | ||||||||
| ok210_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00007151 | ||||||||
| Laboratory | RB | ||||||||
| Person | WBPerson46 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00004509 | |||||||
| Transcript | M01G12.12.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
| VEP_impact | HIGH | ||||||||
| Intron_number | 1-3/22 | ||||||||
| Exon_number | 1-3/23 | ||||||||
| M01G12.12.2 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
| VEP_impact | HIGH | ||||||||
| Intron_number | 2/21 | ||||||||
| Exon_number | 1-2/22 | ||||||||
| Isolation | Mutagen | ||||||||
| Description | Phenotype_not_observed | WBPhenotype:0001759 | Paper_evidence | WBPaper00031962 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | These proteins are not required for piRNA expression, as determined by comparable levels of 21U-RNA on Northern blot and or qRT-PCR to that of wild-type. | Paper_evidence | WBPaper00031962 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | GO_term | GO:0034585 | PATO:0000460 | Paper_evidence | WBPaper00031962 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001776 | Paper_evidence | WBPaper00035324 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | rrf-2(ok210) animals express normal levels of 26G RNAs | Paper_evidence | WBPaper00035324 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00031962 | ||||||||
| WBPaper00035324 | |||||||||
| Remark | Last updated on 29 Nov 2002 | ||||||||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||||
| Method | KO_consortium_allele |
