WormBase Tree Display for Variation: WBVar00091463
expand all nodes | collapse all nodes | view schema
WBVar00091463 | Evidence | Paper_evidence | WBPaper00005122 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | oj55 | |||||||
Other_name | CE03028:p.Ser441Leu | ||||||||
CE30881:p.Ser441Leu | |||||||||
C26D10.5b.1:c.1322C>T | |||||||||
C26D10.5a.1:c.1322C>T | |||||||||
HGVSg | CHROMOSOME_II:g.8348391C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C26D10 | |||||
Flanking_sequences | gattgttcaacttgacagtatatgaggcttctggaaaaattgatggat | agtgaagatgtcaactggatttggatctgatacaattcacacattcactgcttatgttagtgatcttcatgcttcaaaccgttctatgattattccactgccagcca | |||||||
Mapping_target | C26D10 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00040368 | ||||||||
WBStrain00040369 | |||||||||
Laboratory | WH | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001159 | |||||||
Transcript | C26D10.5a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | C26D10.5a.1:c.1322C>T | ||||||||
HGVSp | CE03028:p.Ser441Leu | ||||||||
cDNA_position | 1326 | ||||||||
CDS_position | 1322 | ||||||||
Protein_position | 441 | ||||||||
Exon_number | 8/10 | ||||||||
Codon_change | tCa/tTa | ||||||||
Amino_acid_change | S/L | ||||||||
C26D10.5b.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | C26D10.5b.1:c.1322C>T | ||||||||
HGVSp | CE30881:p.Ser441Leu | ||||||||
cDNA_position | 1332 | ||||||||
CDS_position | 1322 | ||||||||
Protein_position | 441 | ||||||||
Exon_number | 8/10 | ||||||||
Codon_change | tCa/tTa | ||||||||
Amino_acid_change | S/L | ||||||||
Genetics | Interpolated_map_position | II | 0.764006 | ||||||
Description | Phenotype | WBPhenotype:0000072 | Paper_evidence | WBPaper00005122 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutation results in viable worms that show severe body morphology defects | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 15C, 20C, 25C | Paper_evidence | WBPaper00005122 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | jcIs1 [ajm-1::GFP] | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000165 | Paper_evidence | WBPaper00005122 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Most epidermal cells derived the ventral P cells failed to fuse to hyp7 | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006772 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0006773 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0006777 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00005122 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 15C, 20C, 25C | Paper_evidence | WBPaper00005122 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | jcIs1 [ajm-1::GFP] | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000166 | Paper_evidence | WBPaper00005122 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Most epidermal cells derived from lateral seam failed to fuse to hyp7 | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00005122 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 15C, 20C, 25C | Paper_evidence | WBPaper00005122 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | jcIs1 [ajm-1::GFP] | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000702 | Paper_evidence | WBPaper00005122 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | eff-1 (oj55) mutant embryos fail in all epidermal cell fusions | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005122 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 15C, 20C, 25C | Paper_evidence | WBPaper00005122 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | jcIs1 [ajm-1::GFP] | Paper_evidence | WBPaper00005122 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00027244 | ||||||||
WBPaper00019568 | |||||||||
WBPaper00005122 | |||||||||
WBPaper00017872 | |||||||||
WBPaper00023445 | |||||||||
Method | Substitution_allele |