WormBase Tree Display for Variation: WBVar00091378
expand all nodes | collapse all nodes | view schema
| WBVar00091378 | Evidence | Paper_evidence | WBPaper00004692 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | nr2013 | ||||||
| Other_name | C07F11.1.1:c.1448_1896del | |||||||
| CE28818:p.Ile484SerfsTer20 | ||||||||
| HGVSg | CHROMOSOME_I:g.456917_457606del | |||||||
| Sequence_details | SMap | S_parent | Sequence | C07F11 | ||||
| Flanking_sequences | aacttcattccctggacgtgtcgaataatg | aaagtcgtagaggctgtgcatccgttgaaa | ||||||
| Mapping_target | C07F11 | |||||||
| Type_of_mutation | Deletion | |||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00021972 | |||||||
| WBStrain00029108 | ||||||||
| Laboratory | NS | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00006593 | ||||||
| Transcript | C07F11.1.1 (11) | |||||||
| Interactor | WBInteraction000521042 | |||||||
| Genetics | Interpolated_map_position | I | -19.0353 | |||||
| Mapping_data | In_multi_point | 4732 | ||||||
| Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00004692 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | At 25 deg C., tol-1(nr2013) homozygotes are not viable. There is a high proportion of embryonic lethality, and the worms that do hatch arrest as small, deformed larvae. There was a maternal rescue of the embryonic lethality; however maternal rescue was not complete. | Paper_evidence | WBPaper00004692 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00004692 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Maternal | With_maternal_effect | Paper_evidence | WBPaper00004692 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0000059 | Paper_evidence | WBPaper00004692 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | At 15 deg. C., less than 10% of tol-1(nr2013) mutants develop into adults that are marginally fertile, while the majority of worms arrest at different developmental stages and exhibit dramatic defects in morphogenesis. | Paper_evidence | WBPaper00004692 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Reference | WBPaper00004692 | |||||||
| WBPaper00065184 | ||||||||
| Remark | nr2013 mutation is a deletion of 690 bp (positions 36394-37083) of C07F11 | Paper_evidence | WBPaper00004692 | |||||
| Person_evidence | WBPerson499 | |||||||
| Method | Deletion_allele |
