WormBase Tree Display for Variation: WBVar00090965

WBVar00090965 Evidence: Paper_evidence: WBPaper00026975
  Name: Public_name: ne236
    Other_name: CE00315:p.Arg176His
      T05G5.3.1:c.527G>A
    HGVSg: CHROMOSOME_III:g.9748098G>A
  Sequence_details: SMap: S_parent: Sequence: T05G5
    Flanking_sequences: gacttgccagagctattggtatcccgattc cgtttacacgcatgaagtgagtttgcattc
    Mapping_target: T05G5
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00026975
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00040430
    Laboratory: WM
    Status: Live
  Affects: Gene: WBGene00000405
    Transcript: T05G5.3.1 (12)
  Genetics: Interpolated_map_position: III 0.968338
  Description: Phenotype: WBPhenotype:0001133 Paper_evidence: WBPaper00026975
        Curator_confirmed: WBPerson2987
        Remark: Figure S1 legend: "The reorientation of the EMS centrosome-nuclear complex seen in wild-type embryos completely fails to occur in ne236, resulting in a left/right (L/R) cell division of EMS rather than A/P as in wild-type." Paper_evidence: WBPaper00026975
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0006876 PATO:0000460 Paper_evidence: WBPaper00026975
                Curator_confirmed: WBPerson2987
          Life_stage: WBls:0000003 PATO:0000460 Paper_evidence: WBPaper00026975
                Curator_confirmed: WBPerson2987
          GO_term: GO:0051301 PATO:0000460 Paper_evidence: WBPaper00026975
                Curator_confirmed: WBPerson2987
      WBPhenotype:0001635 Paper_evidence: WBPaper00026975
        Curator_confirmed: WBPerson2987
        Remark: Figure S1 legend: "The epidermis of ne236 does not enclose the embryo, while the posterior of the embryo fills with additional intestinal and pharynx cells." Paper_evidence: WBPaper00026975
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0005460 PATO:0000460 Paper_evidence: WBPaper00026975
                Curator_confirmed: WBPerson2987
          Life_stage: WBls:0000003 PATO:0000460 Paper_evidence: WBPaper00026975
                Curator_confirmed: WBPerson2987
          GO_term: GO:0060465 PATO:0000460 Paper_evidence: WBPaper00026975
                Curator_confirmed: WBPerson2987
      WBPhenotype:0001636 Paper_evidence: WBPaper00026975
        Curator_confirmed: WBPerson2987
        Remark: Figure S1 legend: "The epidermis of ne236 does not enclose the embryo, while the posterior of the embryo fills with additional intestinal and pharynx cells." Paper_evidence: WBPaper00026975
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0005792 PATO:0000460 Paper_evidence: WBPaper00026975
                Curator_confirmed: WBPerson2987
          Life_stage: WBls:0000003 PATO:0000460 Paper_evidence: WBPaper00026975
                Curator_confirmed: WBPerson2987
          GO_term: GO:0048565 PATO:0000460 Paper_evidence: WBPaper00026975
                Curator_confirmed: WBPerson2987
      WBPhenotype:0001908 Paper_evidence: WBPaper00026975
        Curator_confirmed: WBPerson2987
        Remark: Figure S1 legend: "The epidermis of ne236 does not enclose the embryo, while the posterior of the embryo fills with additional intestinal and pharynx cells." Paper_evidence: WBPaper00026975
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0005733 PATO:0000460 Paper_evidence: WBPaper00026975
                Curator_confirmed: WBPerson2987
          Life_stage: WBls:0000003 PATO:0000460 Paper_evidence: WBPaper00026975
                Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000354 Paper_evidence: WBPaper00026975
        Curator_confirmed: WBPerson2987
        Remark: "In contrast, cdk-1(ne236), cdk-1(ne2257), and cks-1(ne549) homozygotes have no obvious larval phenotypes and produce mutant embryos with normal cell divisions and well-differentiated cells and tissues (Figure S1, data not shown)." Paper_evidence: WBPaper00026975
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000746 Paper_evidence: WBPaper00026975
        Curator_confirmed: WBPerson2987
        Remark: "In contrast, cdk-1(ne236), cdk-1(ne2257), and cks-1(ne549) homozygotes have no obvious larval phenotypes and produce mutant embryos with normal cell divisions and well-differentiated cells and tissues (Figure S1, data not shown)." Paper_evidence: WBPaper00026975
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000750 Paper_evidence: WBPaper00026975
        Curator_confirmed: WBPerson2987
        Remark: "In contrast, cdk-1(ne236), cdk-1(ne2257), and cks-1(ne549) homozygotes have no obvious larval phenotypes and produce mutant embryos with normal cell divisions and well-differentiated cells and tissues (Figure S1, data not shown)." Paper_evidence: WBPaper00026975
            Curator_confirmed: WBPerson2987
  Reference: WBPaper00026975
    WBPaper00017973
    WBPaper00017984
    WBPaper00018989
  Method: Substitution_allele