WormBase Tree Display for Variation: WBVar00090927
expand all nodes | collapse all nodes | view schema
WBVar00090927 | Evidence | Paper_evidence | WBPaper00003907 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | nc4 | ||||||
Other_name | H30A04.1a.2:c.345_612+177del | |||||||
H30A04.1b.1:c.345_612+177del | ||||||||
H30A04.1a.1:c.345_612+177del | ||||||||
HGVSg | CHROMOSOME_X:g.15517469_15518589del | |||||||
Sequence_details | SMap | S_parent | Sequence | H30A04 | ||||
Flanking_sequences | cgggctcgactgcacattcgagcacggagc | aatgagcaaaaagctatgaactttcggatt | ||||||
Mapping_target | H30A04 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034469 | |||||||
Laboratory | ST | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00197018 | ||||||
WBGene00001148 | ||||||||
Transcript | H30A04.2 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
H30A04.1a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | H30A04.1a.2:c.345_612+177del | |||||||
cDNA_position | 497-? | |||||||
CDS_position | 345-? | |||||||
Protein_position | 115-? | |||||||
Intron_number | 6-8/16 | |||||||
Exon_number | 6-8/17 | |||||||
H30A04.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | H30A04.1b.1:c.345_612+177del | |||||||
cDNA_position | 449-? | |||||||
CDS_position | 345-? | |||||||
Protein_position | 115-? | |||||||
Intron_number | 5-7/15 | |||||||
Exon_number | 5-7/16 | |||||||
H30A04.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | H30A04.1a.1:c.345_612+177del | |||||||
cDNA_position | 447-? | |||||||
CDS_position | 345-? | |||||||
Protein_position | 115-? | |||||||
Intron_number | 5-7/15 | |||||||
Exon_number | 5-7/16 | |||||||
Genetics | Interpolated_map_position | X | 22.811 | |||||
Mapping_data | In_multi_point | 4273 | ||||||
Description | Phenotype | WBPhenotype:0000019 | Paper_evidence | WBPaper00003907 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Pumping rates were reduced about 15% from that observed for wild-type worms. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000103 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Gut granules were small and fewer in number. Animals showed only a slight increase in the intensity of intestinal autofluorescence, which mimicked the phenotype of starved wild-typed worms. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Brood size is 15% smaller than that of wild-type animals. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000293 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals had pale intestines. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000335 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The average time required for transferring a droplet of mineral oil from the anterior metacorpus to the posterior isthmus was significantly longer in these animals when compared to wild-type animals. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000547 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001063 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited extended egg-laying periods. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000145 | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No abnormalities were observed for these mutants. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed no gross morphological defects. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000604 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed no gross morphological defects. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000618 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Coelomocytes were positioned correctly in comparison to control animals, further, coelomocytes retained DiI uptake ability. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No abnormalities were observed for these mutants. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000650 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No abnormalities were observed for these mutants. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000709 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed no gross morphological defects. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000710 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Although the pattern of gut autofluorescence was similar to starved worms, in regards to shape, the intestines in these worms were more similar to that of well-fed wild-type worms, as opposed to being shrunken like those of starved worms. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000980 | Paper_evidence | WBPaper00003907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Muscle contractions and activities of the pharynx appear to be normal and properly synchronized. | Paper_evidence | WBPaper00003907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00004883 | |||||||
WBPaper00003907 | ||||||||
Method | Deletion_allele |