WormBase Tree Display for Variation: WBVar00090924
expand all nodes | collapse all nodes | view schema
WBVar00090924 | Evidence | Paper_evidence | WBPaper00005278 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | nc1 | |||||||
Other_name | C37A5.9.1:c.142C>T | ||||||||
CE30125:p.Arg48Ter | |||||||||
HGVSg | CHROMOSOME_I:g.14178319G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C37A5 | |||||
Flanking_sequences | gacttgttcttcgcaatccgagcatacgaa | gaatggcgttggagggaaaaccggaggtat | |||||||
Mapping_target | C37A5 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | ST | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004202 | |||||||
Transcript | C37A5.9.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C37A5.9.1:c.142C>T | ||||||||
HGVSp | CE30125:p.Arg48Ter | ||||||||
cDNA_position | 146 | ||||||||
CDS_position | 142 | ||||||||
Protein_position | 48 | ||||||||
Exon_number | 3/14 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Genetics | Interpolated_map_position | I | 23.6241 | ||||||
Description | Phenotype | WBPhenotype:0000062 | Paper_evidence | WBPaper00005278 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "This transgene fully rescued the lethality, the multivulva phenotype, and the QR.d migration defect of pry-1(mu38 and nc1)." | Paper_evidence | WBPaper00005278 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00000302 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00003383 | |||||||
WBPaper00005278 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | pry-1(nc1) causes 40% of descendants of the QR neuroblast to stay in the posterior of the animal, as opposed to migrating anteriorly as in wild type animals (Table 1). | Paper_evidence | WBPaper00003383 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"This transgene fully rescued the lethality, the multivulva phenotype, and the QR.d migration defect of pry-1(mu38 and nc1)." | Paper_evidence | WBPaper00005278 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00000302 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00003383 | ||||
WBPaper00005278 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00003383 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00005278 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "This transgene fully rescued the lethality, the multivulva phenotype, and the QR.d migration defect of pry-1(mu38 and nc1)." | Paper_evidence | WBPaper00005278 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Rescued_by_transgene | WBTransgene00000302 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00005278 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0001278 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | neurons did not show a loss in unc-25::GFP expression | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014913 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005027 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005021 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00005278 | ||||||||
WBPaper00003383 | |||||||||
WBPaper00057074 | |||||||||
Method | Substitution_allele |