WormBase Tree Display for Variation: WBVar00090923
expand all nodes | collapse all nodes | view schema
WBVar00090923 | Evidence | Person_evidence | WBPerson318 | ||||||
---|---|---|---|---|---|---|---|---|---|
Author_evidence | Hubbard EJA | ||||||||
Name | Public_name | na48 | |||||||
Other_name | CE03583:p.Asp211Asn | ||||||||
R166.4.1:c.631G>A | |||||||||
HGVSg | CHROMOSOME_II:g.10540883C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | R166 | |||||
Flanking_sequences | tcgaatccacgagttttatcagctggagcc | accatattgcatgtcttcattcaatttcta | |||||||
Mapping_target | R166 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007707 | ||||||||
WBStrain00007708 | |||||||||
Laboratory | GC | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004185 | |||||||
Transcript | R166.4.1 (12) | ||||||||
Interactor (36) | |||||||||
Genetics | Interpolated_map_position | II | 3.07689 | ||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson318 | |||||
Curator_confirmed | WBPerson1845 | ||||||||
WBPhenotype:0000195 | Person_evidence | WBPerson318 | |||||||
Curator_confirmed | WBPerson1845 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson318 | |||||||
Curator_confirmed | WBPerson1845 | ||||||||
WBPhenotype:0000894 | Paper_evidence | WBPaper00034675 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Gonad arms exhibited low penetrance expression of the GLD-1::GFP transgene, indicating a small amount of germ cell differentiation, in the proximal-most region of the germline | Paper_evidence | WBPaper00034675 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | 12% | Paper_evidence | WBPaper00034675 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00034675 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00034675 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | pro-1(na48) II | Paper_evidence | WBPaper00034675 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001033 | Person_evidence | WBPerson318 | |||||||
Curator_confirmed | WBPerson1845 | ||||||||
Remark | mass of proliferating germ cells (tumor) in the proximal part of the adult gonad. Gametes form distal to the proximal tumor. | Person_evidence | WBPerson318 | ||||||
Curator_confirmed | WBPerson1845 | ||||||||
Penetrance | Incomplete | Person_evidence | WBPerson318 | ||||||
Curator_confirmed | WBPerson1845 | ||||||||
Recessive | Person_evidence | WBPerson318 | |||||||
Curator_confirmed | WBPerson1845 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson318 | ||||||
Curator_confirmed | WBPerson1845 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson318 | |||||
Curator_confirmed | WBPerson1845 | ||||||||
WBPhenotype:0001038 | Paper_evidence | WBPaper00034675 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | High | 83-98% | Paper_evidence | WBPaper00034675 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00034675 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00034675 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | pro-1(na48) II | Paper_evidence | WBPaper00034675 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0001180 | Paper_evidence | WBPaper00034675 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Gonad arms did NOT test positive for STYO-12 staining, indicating NO cell death in the proximal-most region of the germline | Paper_evidence | WBPaper00034675 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00034675 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00034675 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | pro-1(na48) II | Paper_evidence | WBPaper00034675 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00034675 | ||||||||
WBPaper00010817 | |||||||||
WBPaper00026327 | |||||||||
WBPaper00010789 | |||||||||
Remark | pro-1(na48) is an hypomorphic allele. The Pro phenotype is most penetrant at 25 degrees yet more severe phenotypes appear at lower temperatures suggesting that the allele is cold sensitive. With regard to the Pro phenotype it is heat sensitive. RNAi experiments support this interpretation | ||||||||
Method | Substitution_allele |