WormBase Tree Display for Variation: WBVar00090474
expand all nodes | collapse all nodes | view schema
WBVar00090474 | Evidence | Paper_evidence | WBPaper00003815 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n2433 | ||||||
Other_name | C48D1.2b.1:c.430G>A | |||||||
CE44550:p.Gly144Ser | ||||||||
CE29088:p.Gly360Ser | ||||||||
C48D1.2a.1:c.1078G>A | ||||||||
HGVSg | CHROMOSOME_IV:g.13200548C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C48D1 | ||||
Flanking_sequences | ccgaaaatcgtttttgtgcaggcttgtcga | gcggttcgttttttattttaattttaatat | ||||||
Mapping_target | C48D1 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003815 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027262 | |||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000417 | ||||||
Transcript | C48D1.2a.1 (12) | |||||||
C48D1.2b.1 (12) | ||||||||
Interactor | WBInteraction000002952 | |||||||
WBInteraction000051723 | ||||||||
WBInteraction000571507 | ||||||||
WBInteraction000571509 | ||||||||
WBInteraction000571511 | ||||||||
WBInteraction000571521 | ||||||||
WBInteraction000571522 | ||||||||
WBInteraction000571523 | ||||||||
WBInteraction000571524 | ||||||||
WBInteraction000571562 | ||||||||
Genetics | Interpolated_map_position | IV | 8.46467 | |||||
Description | Phenotype | WBPhenotype:0000182 | Paper_evidence | WBPaper00038317 | ||||
WBPaper00041673 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Remark | ~12 cells remained alive in the anterior pharynx of ced-3(lf)mutants. | Paper_evidence | WBPaper00038317 | |||||
Curator_confirmed | WBPerson712 | |||||||
"To determine the nature of HBx-induced cell death, we introduced the PhspHBx transgenes into animals defective in ced-3, which encodes a caspase essential for apoptosis (21), or animals defectivein mec-6, which is important for necrosis (22). A strong loss-of-function (lf) mutation in ced-3(n2433) or mec-6(e1342) partially suppressed embryonic lethality caused by HBx overexpression (Fig. 1B), indicating that both apoptotic and necrotic cell death contributes to lethality of HBx transgenic embryos." | Paper_evidence | WBPaper00041673 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
"Loss of egl-1, ced-3, or ced-4 partially suppressed HBx-induced cell death (from 50% to 22-26% PLM death; Fig. 2A), indicating that HBx induces cell death partly through the apoptotic pathway." | Paper_evidence | WBPaper00041673 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00041673 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | [PhspHBx; Psur-5::SUR-5::GFP] | Paper_evidence | WBPaper00041673 | ||||
Curator_confirmed | WBPerson2987 | |||||||
smIs98 [Pmec-3::GFP; Pmec-7::HBx] | Paper_evidence | WBPaper00041673 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000184 | Paper_evidence | WBPaper00005978 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | This mutation blocks almost all cell deaths in C. elegans. | Paper_evidence | WBPaper00005978 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001271 | Paper_evidence | WBPaper00004574 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ced-3 mutants are hypersusceptible to S. typhimurium-mediated killing. ced-3 mutants died much more quickly than wild-type worms when feeding on S. typhimurium, but died at the same rate as wild-type worms when feeding on E. coli. | Paper_evidence | WBPaper00004574 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038317 | |||||||
WBPaper00003815 | ||||||||
WBPaper00005978 | ||||||||
WBPaper00004574 | ||||||||
WBPaper00041673 | ||||||||
Method | Substitution_allele |