WormBase Tree Display for Variation: WBVar00090359
expand all nodes | collapse all nodes | view schema
| WBVar00090359 | Name | Public_name | n2145 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | T01C4.2c.1:c.518G>A | ||||||||
| CE28350:p.Cys173Tyr | |||||||||
| T01C4.2b.1:c.446G>A | |||||||||
| CE28348:p.Cys145Tyr | |||||||||
| CE28349:p.Cys149Tyr | |||||||||
| T01C4.2a.1:c.434G>A | |||||||||
| HGVSg | CHROMOSOME_V:g.7114157G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | T01C4 | |||||
| Flanking_sequences | tcgaaccatcgcgtctttcactttgtgcat | ccataacaatctgtgcaatttctccgtgtc | |||||||
| Mapping_target | T01C4 | ||||||||
| Type_of_mutation | Substitution | g | a | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00005222 | ||||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003849 | |||||||
| Transcript | T01C4.2b.1 (12) | ||||||||
| T01C4.2c.1 (12) | |||||||||
| T01C4.2a.1 (12) | |||||||||
| Genetics | Interpolated_map_position | V | 0.591839 | ||||||
| Mapping_data | In_multi_point | 2050 | |||||||
| In_pos_neg_data | 5975 | ||||||||
| 5977 | |||||||||
| 5980 | |||||||||
| 5982 | |||||||||
| Description | Phenotype | WBPhenotype:0000302 | Paper_evidence | WBPaper00001786 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Defective in chemotaxis to benzaldehyde at all tested dilutions | Paper_evidence | WBPaper00001786 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Benzaldehyde dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000304 | Paper_evidence | WBPaper00001786 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Defective in chemotaxis to isoamyl alcohol at all tested dilutions | Paper_evidence | WBPaper00001786 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001786 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Isoamyl alcohol dilutions range from 1:10 to 1:1000 | Paper_evidence | WBPaper00001786 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_not_observed (13) | |||||||||
| Reference | WBPaper00001786 | ||||||||
| WBPaper00003680 | |||||||||
| WBPaper00021697 | |||||||||
| WBPaper00064927 | |||||||||
| Method | Substitution_allele |
