WormBase Tree Display for Variation: WBVar00090323
expand all nodes | collapse all nodes | view schema
| WBVar00090323 | Evidence | Paper_evidence | WBPaper00003091 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n1997 | |||||||
| Other_name | C48B4.4b.1:c.3232C>T | ||||||||
| C48B4.4a.2:c.3226C>T | |||||||||
| C48B4.4a.1:c.3226C>T | |||||||||
| C48B4.4d.1:c.3433C>T | |||||||||
| CE20575:p.Arg1145Cys | |||||||||
| CE24857:p.Arg1078Cys | |||||||||
| C48B4.4c.1:c.3271C>T | |||||||||
| CE24856:p.Arg1076Cys | |||||||||
| CE27867:p.Arg1091Cys | |||||||||
| HGVSg | CHROMOSOME_III:g.9573298G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C48B4 | |||||
| Flanking_sequences | ccgacacttatcagcatgattaatagagct | gtctaaccggtactgtagatgctgaaatta | |||||||
| Mapping_target | C48B4 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003091 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00027180 | ||||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000421 | |||||||
| Transcript | C48B4.4b.1 (12) | ||||||||
| C48B4.4d.1 (12) | |||||||||
| C48B4.4c.1 (12) | |||||||||
| C48B4.4a.2 (12) | |||||||||
| C48B4.4a.1 (12) | |||||||||
| Genetics | Interpolated_map_position | III | 0.645793 | ||||||
| Description | Phenotype | WBPhenotype:0000885 | Paper_evidence | WBPaper00001438 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Failure to engulf cell corpses | Paper_evidence | WBPaper00001438 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | Complete | Paper_evidence | WBPaper00001438 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Recessive | Paper_evidence | WBPaper00001438 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBbt:0005739 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001438 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBls:0000037 | PATO:0000460 | Paper_evidence | WBPaper00001438 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | |||||||||
| Phenotype_not_observed | WBPhenotype:0001208 | Paper_evidence | WBPaper00027644 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Remark | Animals were not resistant to RNAi as assayed on either pop-1 RNAi or unc-22 RNAi. | Paper_evidence | WBPaper00027644 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Phenotype_assay | Treatment | Animals reared on both pop-1 and unc-22 feeding plates at 15, 20, 25, and 26C. | Paper_evidence | WBPaper00027644 | |||||
| Curator_confirmed | WBPerson557 | ||||||||
| Reference | WBPaper00003091 | ||||||||
| WBPaper00001438 | |||||||||
| WBPaper00022142 | |||||||||
| WBPaper00027644 | |||||||||
| Method | Substitution_allele |
