WormBase Tree Display for Variation: WBVar00090305
expand all nodes | collapse all nodes | view schema
WBVar00090305 | Evidence | Paper_evidence | WBPaper00001952 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1950 | |||||||
Other_name | T07C4.8.1:c.506G>A | ||||||||
CE25104:p.Gly169Glu | |||||||||
HGVSg | CHROMOSOME_III:g.10335725G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T07C4 | |||||
Flanking_sequences | cacagacagatcaatgtccaatgtcttatg | acgtttggtaagggagaaaatactgaaaaa | |||||||
Mapping_target | T07C4 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001952 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (2) | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00090306 | ||||||||
WBVar00090307 | |||||||||
Affects | Gene | WBGene00000423 | |||||||
Transcript | T07C4.8.1 (12) | ||||||||
Interactor | WBInteraction000001555 | ||||||||
WBInteraction000001629 | |||||||||
WBInteraction000051724 | |||||||||
WBInteraction000052048 | |||||||||
WBInteraction000500984 | |||||||||
WBInteraction000521674 | |||||||||
WBInteraction000521794 | |||||||||
WBInteraction000525163 | |||||||||
WBInteraction000562577 | |||||||||
WBInteraction000571525 | |||||||||
Genetics | Interpolated_map_position | III | 2.35521 | ||||||
Mapping_data | In_multi_point | 1808 | |||||||
1809 | |||||||||
1810 | |||||||||
1811 | |||||||||
1812 | |||||||||
1813 | |||||||||
1814 | |||||||||
1815 | |||||||||
1816 | |||||||||
1819 | |||||||||
Description | Phenotype (14) | ||||||||
Phenotype_not_observed | WBPhenotype:0001401 | Paper_evidence | WBPaper00032231 | ||||||
WBPaper00033026 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
Remark | Mean mitochondrial length was similar to control animals, although the diameter of mitochondria occasionally appeared slightly larger than those of other genotypes. Trasmission EM analysis did not reveal any gross mitochondrial abnormalities in body wall muscle or hypodermis. | Paper_evidence | WBPaper00032231 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Mitochondria in mutant embryos embryos appeared similar to those observed in N2 embryos. Mitochondria in the germline, gut, and muscle cells of adult egl-1(lf), ced-9(lf); ced-3(lf), or ced-9(gf) mutants also appeared to be normal | Paper_evidence | WBPaper00033026 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00032231 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00032231 | ||||||
WBPaper00033026 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0003675 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00033026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
GO_term | GO:0005739 | PATO:0000460 | Paper_evidence | WBPaper00032231 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Young adults were stained with Mito Tracker Red CMXRos. | Paper_evidence | WBPaper00032231 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001650 | Paper_evidence | WBPaper00031571 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Germ cells of animals are condensed and unhealthy like that of germs cells in wild type animals grown on 5-FU. | Paper_evidence | WBPaper00031571 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown on plates containing 400nM 5-FU for 12 hours from late L4 stage. | Paper_evidence | WBPaper00031571 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001651 | Paper_evidence | WBPaper00031571 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not progress to L4 (data not shown). | Paper_evidence | WBPaper00031571 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Embryos were transferred to plates containing 5-FU and remaining larva were counted after 72 hours. | Paper_evidence | WBPaper00031571 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001851 | Paper_evidence | WBPaper00027700 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants did not display significant radiosensitivity when compared with WT N2 C. elegans | Paper_evidence | WBPaper00027700 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00027700 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 100-400 Gy radiation | Paper_evidence | WBPaper00027700 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (30) | |||||||||
Method | Substitution_allele |