WormBase Tree Display for Variation: WBVar00090232
expand all nodes | collapse all nodes | view schema
WBVar00090232 | Evidence | Paper_evidence | WBPaper00035332 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1653 | |||||||
Other_name | T07C4.8.1:c.445T>A | ||||||||
CE25104:p.Tyr149Asn | |||||||||
HGVSg | CHROMOSOME_III:g.10335664T>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T07C4 | |||||
Flanking_sequences | ctcgcagtgcccagaatctcattttcactg | atcaggatgtggttcggacggttggaaatg | |||||||
Mapping_target | T07C4 | ||||||||
Type_of_mutation | Substitution | t | a | Paper_evidence | WBPaper00035332 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00024084 | ||||||||
WBStrain00027104 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000423 | |||||||
Transcript | T07C4.8.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | T07C4.8.1:c.445T>A | ||||||||
HGVSp | CE25104:p.Tyr149Asn | ||||||||
cDNA_position | 445 | ||||||||
CDS_position | 445 | ||||||||
Protein_position | 149 | ||||||||
Exon_number | 2/5 | ||||||||
Codon_change | Tat/Aat | ||||||||
Amino_acid_change | Y/N | ||||||||
Genetics | Interpolated_map_position | III | 2.35497 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000121 | Paper_evidence | WBPaper00049178 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | When the function of Bcl-2 was abrogated in the ced-9ts strain, the distribution of gpd-3 mRNA among polysomes broadened, but the median of the message distribution mirrored that of the wild type strain (Fig. 3E). The ced-9ts strain showed consistent, modest increases in hsp-3 mRNA translational efficiency (Fig. 3F-G).This increase is significant due to the overall shift of the mRNA density into the more efficiently translating fractions near the bottom of the gradient. There was o change in the efficiency of hsp-4 translation in ced-9ts worms (Fig. 3I) relative to wild type. ced-4 mRNA underwent a significant decrease in translational efficiency in the ced-9ts (Fig. 5H) strain. | Paper_evidence | WBPaper00049178 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00049178 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000930 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The sexual fates of multiple sexually dimorphic cells are altered | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001172 | Paper_evidence | WBPaper00004574 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ced-9(n1653ts) loss-of-function mutant exhibited elevated PCD in the gonads (data not shown). | Paper_evidence | WBPaper00004574 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00004574 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001180 | Paper_evidence | WBPaper00040175 | |||||||
WBPaper00049178 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Growth of ced-9ts young adult worms at 25 deg C for 36h caused accumulation of numerous germ cell corpses decorated with ced-1::GFP fluorescence. | Paper_evidence | WBPaper00040175 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
The ced-9ts strain showed a significant increase in apoptotic corpses in the young adult stages (24-48h) that mirrored the changes observed in the ifg-1::mos strain. | Paper_evidence | WBPaper00049178 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00040175 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | mab-5(mu114) | Paper_evidence | WBPaper00049178 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001220 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSNs undergo embryonic apoptosis in hermaphrodites. | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001355 | Paper_evidence | WBPaper00040175 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The young gonad showed normal morphology of surrounding early and late-staged oocytes and the organ as a whole. | Paper_evidence | WBPaper00040175 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00040175 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040175 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Biochemical analysis of IFG-1 p170 by western blot, revealed that these worms accumulate N-terminal cleavage products. | Paper_evidence | WBPaper00040175 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00040175 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001807 | Paper_evidence | WBPaper00049178 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Importantly, the activation of the caspase, CED-3, in the ced-9ts strain causes IFG-1 p170 cleavage to a p130-like product, perhaps promoting a similar out come to the ifg-1::mos allele. | Paper_evidence | WBPaper00049178 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | mab-5(mu114) | Paper_evidence | WBPaper00049178 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Weak loss of function, viable. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000691 | Paper_evidence | WBPaper00049178 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | strains showed normally developed gonads with a typical linearprogression of developing germ cells that mature into oocytes | Paper_evidence | WBPaper00049178 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | mab-5(mu114) | Paper_evidence | WBPaper00049178 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00004574 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The ced-9(n1653ts) mutant had a short lifespan when feeding on S. typhimurium and a short lifespan when feeding on E. coli. Therefore, the relative mortality of ced-9 worms feeding on S. typhimurium was not significantly different from control wild-type worms. | Paper_evidence | WBPaper00004574 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001401 | Paper_evidence | WBPaper00033026 | |||||||
WBPaper00035144 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mitochondria in mutant embryos embryos appeared similar to those observed in N2 embryos. Mitochondria in the germline, gut, and muscle cells of adult egl-1(lf), ced-9(lf); ced-3(lf), or ced-9(gf) mutants also appeared to be normal | Paper_evidence | WBPaper00033026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
No defects in mitochondrial morphology in ced-9(n1653ts) embryos at the nonpermissive temperature | Paper_evidence | WBPaper00035144 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0003675 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00033026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00033026 | ||||||
WBPaper00035144 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00040175 | ||||||||
WBPaper00021826 | |||||||||
WBPaper00004574 | |||||||||
WBPaper00035332 | |||||||||
WBPaper00033026 | |||||||||
WBPaper00035144 | |||||||||
WBPaper00001105 | |||||||||
WBPaper00049178 | |||||||||
Method | Substitution_allele |