WormBase Tree Display for Variation: WBVar00089845
expand all nodes | collapse all nodes | view schema
| WBVar00089845 | Evidence | Paper_evidence | WBPaper00004314 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n943 | |||||||
| Other_name | ZK637.7b.1:c.1159C>T | ||||||||
| CE28195:p.Gln387Ter | |||||||||
| CE28194:p.Gln385Ter | |||||||||
| ZK637.7a.1:c.1153C>T | |||||||||
| HGVSg | CHROMOSOME_III:g.8902250G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | ZK637 | |||||
| Flanking_sequences | gatttgttgagtatcgcctacttcattgaa | aagccaactctaagcttccatcaggcgttc | |||||||
| Mapping_target | ZK637 | ||||||||
| Type_of_mutation | Substitution | c | t | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00027206 | ||||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00002998 | |||||||
| Transcript | ZK637.7b.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK637.7b.1:c.1159C>T | ||||||||
| HGVSp | CE28195:p.Gln387Ter | ||||||||
| cDNA_position | 1165 | ||||||||
| CDS_position | 1159 | ||||||||
| Protein_position | 387 | ||||||||
| Exon_number | 7/11 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| ZK637.7a.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK637.7a.1:c.1153C>T | ||||||||
| HGVSp | CE28194:p.Gln385Ter | ||||||||
| cDNA_position | 1159 | ||||||||
| CDS_position | 1153 | ||||||||
| Protein_position | 385 | ||||||||
| Exon_number | 7/11 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Interactor | WBInteraction000518983 | ||||||||
| Genetics | Interpolated_map_position | III | -0.00691211 | ||||||
| Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00004314 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Brood size is reduced compared to wild-type | Paper_evidence | WBPaper00004314 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000399 | Paper_evidence | WBPaper00004314 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | The presence of sperm in the body cavity and/or distal gonad demonstrates that the structural integrity of the hermaphrodite gonad is compromised | Paper_evidence | WBPaper00004314 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004314 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000668 | Paper_evidence | WBPaper00004314 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Hermaphrodites had endomitotic oocytes within the proximal oviduct | Paper_evidence | WBPaper00004314 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00004314 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000688 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Sterile non-Muv alone | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000700 | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Non-Muv alone. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00014474 | ||||||||
| WBPaper00004314 | |||||||||
| Method | Substitution_allele |
