WormBase Tree Display for Variation: WBVar00089737
expand all nodes | collapse all nodes | view schema
| WBVar00089737 | Evidence | Paper_evidence | WBPaper00003632 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n766 | |||||
| Other_name | CE30992:p.Tyr796Ter | ||||||
| F44B9.6.1:c.2388T>A | |||||||
| HGVSg | CHROMOSOME_III:g.8017886A>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F44B9 | |||
| Flanking_sequences | ttcaacttccatatccgttgctggaatcag | tactcatcagaaacaaccaccggagaagat | |||||
| Mapping_target | F44B9 | ||||||
| Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00026879 | ||||||
| WBStrain00026897 | |||||||
| WBStrain00027237 | |||||||
| WBStrain00027246 | |||||||
| WBStrain00027359 | |||||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003021 | |||||
| Transcript | F44B9.6.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F44B9.6.1:c.2388T>A | ||||||
| HGVSp | CE30992:p.Tyr796Ter | ||||||
| cDNA_position | 2391 | ||||||
| CDS_position | 2388 | ||||||
| Protein_position | 796 | ||||||
| Exon_number | 9/12 | ||||||
| Codon_change | taT/taA | ||||||
| Amino_acid_change | Y/* | ||||||
| Interactor (42) | |||||||
| Isolation | Mutagen | EMS | Paper_evidence | WBPaper00003632 | |||
| Genetics | Interpolated_map_position | III | -0.446789 | ||||
| Mapping_data | In_multi_point | 874 | |||||
| 875 | |||||||
| 876 | |||||||
| 877 | |||||||
| 878 | |||||||
| 1098 | |||||||
| 1105 | |||||||
| 1107 | |||||||
| 1886 | |||||||
| In_pos_neg_data | 4346 | ||||||
| Description | Phenotype_not_observed (3) | ||||||
| Reference | WBPaper00021002 | ||||||
| WBPaper00014834 | |||||||
| WBPaper00038168 | |||||||
| WBPaper00027135 | |||||||
| WBPaper00016177 | |||||||
| WBPaper00014833 | |||||||
| WBPaper00016178 | |||||||
| WBPaper00010946 | |||||||
| WBPaper00044900 | |||||||
| Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
| Method | Substitution_allele |
