WormBase Tree Display for Variation: WBVar00089681
expand all nodes | collapse all nodes | view schema
WBVar00089681 | Evidence | Paper_evidence | WBPaper00002034 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n695 | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK287 | |||||
Flanking_sequences | tatccatcattcaaccaaatgacactgcag | gatgcctatctcctgactgaacccaccagt | |||||||
Mapping_target | ZK287 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002034 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026851 | ||||||||
WBStrain00040284 | |||||||||
WBStrain00040285 | |||||||||
WBStrain00040305 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001842 | |||||||
Interactor (11) | |||||||||
Genetics | Interpolated_map_position | V | 2.07295 | ||||||
Mapping_data | In_multi_point | 739 | |||||||
Description | Phenotype (11) | ||||||||
Phenotype_not_observed | WBPhenotype:0001021 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO animals WT | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (32) | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001842 Genomic_neighbourhood | Paper_evidence | WBPaper00002034 | ||||||
Method | Substitution_allele |