WormBase Tree Display for Variation: WBVar00089525
expand all nodes | collapse all nodes | view schema
WBVar00089525 | Evidence | Paper_evidence | WBPaper00005774 | ||
---|---|---|---|---|---|
WBPaper00005620 | |||||
Name | Public_name | n478 | |||
Other_name (16) | |||||
HGVSg | CHROMOSOME_IV:g.1876036G>A | ||||
Sequence_details | SMap | S_parent | Sequence | F55A8 | |
Flanking_sequences | ggctagcgacacttggagttggaggatttg | aagagttgaacttgtctgtgtaaatggaga | |||
Mapping_target | F55A8 | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00026779 | ||||
Laboratory | MT | ||||
Status | Live | ||||
Affects | Gene | WBGene00001173 | |||
Transcript | F55A8.2g.1 (12) | ||||
F55A8.2e.1 (12) | |||||
F55A8.2d.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | F55A8.2d.1:c.492+2344G>A | ||||
Intron_number | 3/3 | ||||
F55A8.2f.1 (12) | |||||
F55A8.2b.1 (12) | |||||
F55A8.2c.1 (12) | |||||
F55A8.2h.1 (12) | |||||
F55A8.2a.2 (12) | |||||
F55A8.2a.1 (12) | |||||
Genetics | Interpolated_map_position | IV | -14.2673 | ||
Mapping_data | In_multi_point | 610 | |||
3182 | |||||
3184 | |||||
5457 | |||||
Description | Phenotype (39) | ||||
Phenotype_not_observed (14) | |||||
Reference (18) | |||||
Remark | affects the kinase domain | ||||
n478 has a (G481E) missense mutation in the kinase domain | Paper_evidence | WBPaper00005774 | |||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Method | Substitution_allele |