WormBase Tree Display for Variation: WBVar00089525
expand all nodes | collapse all nodes | view schema
WBVar00089525 | Evidence | Paper_evidence | WBPaper00005774 | |||
---|---|---|---|---|---|---|
WBPaper00005620 | ||||||
Name | Public_name | n478 | ||||
Other_name (16) | ||||||
HGVSg | CHROMOSOME_IV:g.1876036G>A | |||||
Sequence_details | SMap | S_parent | Sequence | F55A8 | ||
Flanking_sequences | ggctagcgacacttggagttggaggatttg | aagagttgaacttgtctgtgtaaatggaga | ||||
Mapping_target | F55A8 | |||||
Type_of_mutation | Substitution | g | a | |||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin | Species | Caenorhabditis elegans | ||||
Strain | WBStrain00026779 | |||||
Laboratory | MT | |||||
Status | Live | |||||
Affects | Gene | WBGene00001173 | ||||
Transcript | F55A8.2g.1 | VEP_consequence | missense_variant | |||
VEP_impact | MODERATE | |||||
SIFT | 0 | deleterious_low_confidence | ||||
PolyPhen | 1 | probably_damaging | ||||
HGVSc | F55A8.2g.1:c.554G>A | |||||
HGVSp | CE49110:p.Gly185Glu | |||||
cDNA_position | 554 | |||||
CDS_position | 554 | |||||
Protein_position | 185 | |||||
Exon_number | 3/5 | |||||
Codon_change | gGa/gAa | |||||
Amino_acid_change | G/E | |||||
F55A8.2e.1 (12) | ||||||
F55A8.2d.1 | VEP_consequence | intron_variant | ||||
VEP_impact | MODIFIER | |||||
HGVSc | F55A8.2d.1:c.492+2344G>A | |||||
Intron_number | 3/3 | |||||
F55A8.2f.1 (12) | ||||||
F55A8.2b.1 (12) | ||||||
F55A8.2c.1 (12) | ||||||
F55A8.2h.1 (12) | ||||||
F55A8.2a.2 (12) | ||||||
F55A8.2a.1 (12) | ||||||
Genetics | Interpolated_map_position | IV | -14.2673 | |||
Mapping_data | In_multi_point | 610 | ||||
3182 | ||||||
3184 | ||||||
5457 | ||||||
Description | Phenotype (39) | |||||
Phenotype_not_observed (14) | ||||||
Reference (18) | ||||||
Remark | affects the kinase domain | |||||
n478 has a (G481E) missense mutation in the kinase domain | Paper_evidence | WBPaper00005774 | ||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||
Method | Substitution_allele |