WormBase Tree Display for Variation: WBVar00089283
expand all nodes | collapse all nodes | view schema
| WBVar00089283 | Evidence | Paper_evidence | WBPaper00001306 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n137 | |||||||
| Other_name | n137sd | ||||||||
| CE00274:p.Ser872Phe | |||||||||
| R107.8.1:c.2615C>T | |||||||||
| HGVSg | CHROMOSOME_III:g.9062774G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | R107 | |||||
| Flanking_sequences | aggatgctcaaagtgttgttgactcaatat | tgcaaggcttgcaaagaagggaatcgattc | |||||||
| Mapping_target | R107 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00001306 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (11) | |||||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Linked_to | WBVar00089284 | ||||||||
| WBVar00089285 | |||||||||
| Affects | Gene | WBGene00003001 | |||||||
| Transcript | R107.8.1 | VEP_consequence | missense_variant | ||||||
| VEP_impact | MODERATE | ||||||||
| HGVSc | R107.8.1:c.2615C>T | ||||||||
| HGVSp | CE00274:p.Ser872Phe | ||||||||
| cDNA_position | 2699 | ||||||||
| CDS_position | 2615 | ||||||||
| Protein_position | 872 | ||||||||
| Exon_number | 9/12 | ||||||||
| Codon_change | tCt/tTt | ||||||||
| Amino_acid_change | S/F | ||||||||
| Interactor | WBInteraction000007801 | ||||||||
| WBInteraction000052051 | |||||||||
| WBInteraction000501323 | |||||||||
| WBInteraction000503535 | |||||||||
| WBInteraction000519194 | |||||||||
| WBInteraction000524399 | |||||||||
| WBInteraction000524412 | |||||||||
| WBInteraction000554933 | |||||||||
| WBInteraction000556888 | |||||||||
| WBInteraction000558854 | |||||||||
| Isolation | Mutagen | EMS | |||||||
| Genetics | Interpolated_map_position | III | 0.132814 | ||||||
| Mapping_data | In_2_point | 6197 | |||||||
| In_multi_point | 387 | ||||||||
| 404 | |||||||||
| 405 | |||||||||
| 406 | |||||||||
| 409 | |||||||||
| 412 | |||||||||
| 1573 | |||||||||
| 1575 | |||||||||
| 2463 | |||||||||
| Description | Phenotype (16) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000594 | Paper_evidence | WBPaper00004662 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Moreover, heterozygotes or homozygotes for the dominant gain-of-function allele lin-12(n137) have two Y cells that are usually positioned left-right of each other and this does not appear to have a strong effect on the orientation of P11/12 migration (Table 2B)." | Paper_evidence | WBPaper00004662 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00004662 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference (25) | |||||||||
| Method | Substitution_allele |
