WormBase Tree Display for Variation: WBVar00089283
expand all nodes | collapse all nodes | view schema
WBVar00089283 | Evidence | Paper_evidence | WBPaper00001306 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n137 | |||||||
Other_name | n137sd | ||||||||
CE00274:p.Ser872Phe | |||||||||
R107.8.1:c.2615C>T | |||||||||
HGVSg | CHROMOSOME_III:g.9062774G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R107 | |||||
Flanking_sequences | aggatgctcaaagtgttgttgactcaatat | tgcaaggcttgcaaagaagggaatcgattc | |||||||
Mapping_target | R107 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00001306 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (11) | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00089284 | ||||||||
WBVar00089285 | |||||||||
Affects | Gene | WBGene00003001 | |||||||
Transcript | R107.8.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | R107.8.1:c.2615C>T | ||||||||
HGVSp | CE00274:p.Ser872Phe | ||||||||
cDNA_position | 2699 | ||||||||
CDS_position | 2615 | ||||||||
Protein_position | 872 | ||||||||
Exon_number | 9/12 | ||||||||
Codon_change | tCt/tTt | ||||||||
Amino_acid_change | S/F | ||||||||
Interactor | WBInteraction000007801 | ||||||||
WBInteraction000052051 | |||||||||
WBInteraction000501323 | |||||||||
WBInteraction000503535 | |||||||||
WBInteraction000519194 | |||||||||
WBInteraction000524399 | |||||||||
WBInteraction000524412 | |||||||||
WBInteraction000554933 | |||||||||
WBInteraction000556888 | |||||||||
WBInteraction000558854 | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | III | 0.132814 | ||||||
Mapping_data | In_2_point | 6197 | |||||||
In_multi_point | 387 | ||||||||
404 | |||||||||
405 | |||||||||
406 | |||||||||
409 | |||||||||
412 | |||||||||
1573 | |||||||||
1575 | |||||||||
2463 | |||||||||
Description | Phenotype (16) | ||||||||
Phenotype_not_observed | WBPhenotype:0000594 | Paper_evidence | WBPaper00004662 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Moreover, heterozygotes or homozygotes for the dominant gain-of-function allele lin-12(n137) have two Y cells that are usually positioned left-right of each other and this does not appear to have a strong effect on the orientation of P11/12 migration (Table 2B)." | Paper_evidence | WBPaper00004662 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00004662 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00039839 | ||||||||
WBPaper00027236 | |||||||||
WBPaper00028766 | |||||||||
WBPaper00016092 | |||||||||
WBPaper00004710 | |||||||||
WBPaper00000762 | |||||||||
WBPaper00031590 | |||||||||
WBPaper00013862 | |||||||||
WBPaper00015978 | |||||||||
WBPaper00032102 | |||||||||
WBPaper00016174 | |||||||||
WBPaper00022275 | |||||||||
WBPaper00017507 | |||||||||
WBPaper00013903 | |||||||||
WBPaper00014705 | |||||||||
WBPaper00001306 | |||||||||
WBPaper00001778 | |||||||||
WBPaper00005255 | |||||||||
WBPaper00015248 | |||||||||
WBPaper00012608 | |||||||||
WBPaper00014324 | |||||||||
WBPaper00000646 | |||||||||
WBPaper00016269 | |||||||||
WBPaper00014117 | |||||||||
WBPaper00004662 | |||||||||
Method | Substitution_allele |