WormBase Tree Display for Variation: WBVar00089282
expand all nodes | collapse all nodes | view schema
WBVar00089282 | Evidence | Paper_evidence | WBPaper00004314 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n112 | ||||||
Other_name | ZK637.7b.1:c.1022G>A | |||||||
CE28194:p.Gly339Glu | ||||||||
CE28195:p.Gly341Glu | ||||||||
ZK637.7a.1:c.1016G>A | ||||||||
HGVSg | CHROMOSOME_III:g.8902862C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK637 | ||||
Flanking_sequences | ttcgaaatccctacgatggaatttattctg | aattattgatgctgtcattccgaaaggatt | ||||||
Mapping_target | ZK637 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004299 | |||||||
WBStrain00026703 | ||||||||
WBStrain00026741 | ||||||||
WBStrain00026768 | ||||||||
WBStrain00026837 | ||||||||
WBStrain00026876 | ||||||||
WBStrain00026877 | ||||||||
WBStrain00026898 | ||||||||
WBStrain00026939 | ||||||||
WBStrain00026940 | ||||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002998 | ||||||
Transcript | ZK637.7b.1 (12) | |||||||
ZK637.7a.1 (12) | ||||||||
Interactor (21) | ||||||||
Genetics | Interpolated_map_position | III | -0.00625479 | |||||
Mapping_data | In_2_point | 406 | ||||||
407 | ||||||||
In_multi_point | 325 | |||||||
384 | ||||||||
385 | ||||||||
386 | ||||||||
387 | ||||||||
Description | Phenotype | WBPhenotype:0000059 | Paper_evidence | WBPaper00038168 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals show larval arrest at 26 deg C. | Paper_evidence | WBPaper00038168 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 26 | Paper_evidence | WBPaper00038168 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00049368 | ||||||
Curator_confirmed | WBPerson632 | |||||||
WBPhenotype:0001258 | Paper_evidence | WBPaper00027135 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00046889 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Mutation caused ectopic accumulation of GFP::PGL-1 granules in somatic cells. | Paper_evidence | WBPaper00046889 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001593 | Paper_evidence | WBPaper00046889 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Authors found that expression of SCM::GFP was significantly reduced. | Paper_evidence | WBPaper00046889 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000700 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Adult hermaphrodite wildtype. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference (11) | ||||||||
Method | Substitution_allele |