WormBase Tree Display for Variation: WBVar00089143
expand all nodes | collapse all nodes | view schema
WBVar00089143 | Evidence | Paper_evidence | WBPaper00002087 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | mn392 | ||||||
Other_name | CE06757:p.Ser140Ter | |||||||
C02H7.1.1:c.419C>G | ||||||||
HGVSg | CHROMOSOME_X:g.764797C>G | |||||||
Sequence_details | SMap | S_parent | Sequence | C02H7 | ||||
Flanking_sequences | aggacaaaaagggagatgaagaagagaagt | aactactaaaaaacgtagcagtaagaaggt | ||||||
Mapping_target | C02H7 | |||||||
Type_of_mutation | Substitution | c | g | Paper_evidence | WBPaper00031624 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034382 | |||||||
Laboratory | SP | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001127 | ||||||
Transcript | C02H7.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C02H7.1.1:c.419C>G | |||||||
HGVSp | CE06757:p.Ser140Ter | |||||||
cDNA_position | 436 | |||||||
CDS_position | 419 | |||||||
Protein_position | 140 | |||||||
Exon_number | 4/9 | |||||||
Codon_change | tCa/tGa | |||||||
Amino_acid_change | S/* | |||||||
Interactor | WBInteraction000503546 | |||||||
WBInteraction000503547 | ||||||||
WBInteraction000503548 | ||||||||
WBInteraction000503549 | ||||||||
Genetics | Interpolated_map_position | X | -19.5015 | |||||
Mapping_data | In_multi_point | 3080 | ||||||
3081 | ||||||||
3082 | ||||||||
3083 | ||||||||
Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00002087 | ||||
Curator_confirmed | WBPerson48 | |||||||
Remark | 1-20% as many dauers formed as for N2. | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00002087 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Remark | Slightly short. | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
Animals slightly short. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | 10-30% as efficient mating as N2. | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001434 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Chemotaxis defective. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001435 | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Chemotaxis frequency 0.07 versus 0.71 for N2. | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0002053 | Paper_evidence | WBPaper00055368 | ||||||
Curator_confirmed | WBPerson466 | |||||||
Remark | survive 10nM ivermectin | Paper_evidence | WBPaper00055368 | |||||
Curator_confirmed | WBPerson466 | |||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00055368 | ||||
Curator_confirmed | WBPerson466 | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00002087 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Remark | Defects in dye filling. | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
Defective in dye (FITC or DiO) filling of amphid and phasmid neurons. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_not_observed | WBPhenotype:0000398 | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000646 | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Normal mobility when prodded. | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
Reference | WBPaper00002087 | |||||||
WBPaper00055368 | ||||||||
Method | Substitution_allele |