WormBase Tree Display for Variation: WBVar00089001
expand all nodes | collapse all nodes | view schema
WBVar00089001 | Evidence | Person_evidence | WBPerson552 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | mn19 | ||||||
Other_name | CE37536:p.Ser840Asn | |||||||
K08F8.6.1:c.2519G>A | ||||||||
HGVSg | CHROMOSOME_II:g.8774374G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | K08F8 | ||||
Flanking_sequences | aatggttgaagaaagcaagaaggaaagtta | caaacaacagataaagaaggcggggcagta | ||||||
Mapping_target | K08F8 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034213 | |||||||
Laboratory | SP | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002295 | ||||||
Transcript | K08F8.6.1 (12) | |||||||
Interactor | WBInteraction000502049 | |||||||
WBInteraction000502050 | ||||||||
Genetics | Interpolated_map_position | II | 0.886834 | |||||
Mapping_data | In_multi_point | 1467 | ||||||
In_pos_neg_data (19) | ||||||||
Description | Phenotype | WBPhenotype:0000054 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00048990 | ||||||
Curator_confirmed | WBPerson3947 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00048990 | ||||||
Curator_confirmed | WBPerson3947 | |||||||
Phenotype_assay | Genotype | arIs92 [egl-17::NLS-CFP-lacZ; tax-3::GFP; unc-4(+)] | Paper_evidence | WBPaper00048990 | ||||
Curator_confirmed | WBPerson3947 | |||||||
Reference | WBPaper00048990 | |||||||
Remark | This allele describes two mutations. A S840N mutation is coupled with a downstream nonsense mutation W2230 to stop (tgg->tga) | Person_evidence | WBPerson552 | |||||
Method | Substitution_allele |