WormBase Tree Display for Variation: WBVar00089001
expand all nodes | collapse all nodes | view schema
WBVar00089001 | Evidence | Person_evidence | WBPerson552 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | mn19 | ||||||
Other_name | CE37536:p.Ser840Asn | |||||||
K08F8.6.1:c.2519G>A | ||||||||
HGVSg | CHROMOSOME_II:g.8774374G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | K08F8 | ||||
Flanking_sequences | aatggttgaagaaagcaagaaggaaagtta | caaacaacagataaagaaggcggggcagta | ||||||
Mapping_target | K08F8 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034213 | |||||||
Laboratory | SP | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002295 | ||||||
Transcript | K08F8.6.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
SIFT | 0.05 | deleterious_low_confidence | ||||||
PolyPhen | 0 | unknown | ||||||
HGVSc | K08F8.6.1:c.2519G>A | |||||||
HGVSp | CE37536:p.Ser840Asn | |||||||
cDNA_position | 2621 | |||||||
CDS_position | 2519 | |||||||
Protein_position | 840 | |||||||
Exon_number | 11/22 | |||||||
Codon_change | aGc/aAc | |||||||
Amino_acid_change | S/N | |||||||
Interactor | WBInteraction000502049 | |||||||
WBInteraction000502050 | ||||||||
Genetics | Interpolated_map_position | II | 0.886834 | |||||
Mapping_data | In_multi_point | 1467 | ||||||
In_pos_neg_data | 1167 | |||||||
1170 | ||||||||
1173 | ||||||||
1176 | ||||||||
1179 | ||||||||
1184 | ||||||||
1188 | ||||||||
1192 | ||||||||
1196 | ||||||||
1200 | ||||||||
1204 | ||||||||
1267 | ||||||||
1282 | ||||||||
1283 | ||||||||
1295 | ||||||||
1303 | ||||||||
1312 | ||||||||
1368 | ||||||||
1788 | ||||||||
Description | Phenotype | WBPhenotype:0000054 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00048990 | ||||||
Curator_confirmed | WBPerson3947 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00048990 | ||||||
Curator_confirmed | WBPerson3947 | |||||||
Phenotype_assay | Genotype | arIs92 [egl-17::NLS-CFP-lacZ; tax-3::GFP; unc-4(+)] | Paper_evidence | WBPaper00048990 | ||||
Curator_confirmed | WBPerson3947 | |||||||
Reference | WBPaper00048990 | |||||||
Remark | This allele describes two mutations. A S840N mutation is coupled with a downstream nonsense mutation W2230 to stop (tgg->tga) | Person_evidence | WBPerson552 | |||||
Method | Substitution_allele |