WormBase Tree Display for Variation: WBVar00088924
expand all nodes | collapse all nodes | view schema
WBVar00088924 | Evidence | Paper_evidence | WBPaper00006145 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | mg285 | ||||||
Other_name | F13D11.2a.1:c.40_254del | |||||||
CE27956:p.Ala14ThrfsTer10 | ||||||||
HGVSg | CHROMOSOME_X:g.5823105_5823405del | |||||||
Sequence_details | SMap | S_parent | Sequence | F13D11 | ||||
Flanking_sequences | tccgatagtccagaagaattggcacaaaga | acaacaacccggagaaaagattcatcctga | ||||||
Mapping_target | F13D11 | |||||||
Type_of_mutation | Deletion | gcaaagccagcctggaggttacaacagatgcctgtacagctcagcaattttgtgtcaaaaacacctttaatagggtgagttgatttgacacttattttcttaactgcaaattatcaaaatttcaaacttttctgaaagttaaatgatttttgtgttatagatcagaatggcctcctactggtgattggagaagtgccaacaataacagtcttggcgattggaataaatgttgtgttcctggatcagagattcctcaacacttaggtccatttggcaattcatcattgacgatgctgactgc | Paper_evidence | WBPaper00005909 | ||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00005179 | |||||||
Laboratory | GR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001824 | ||||||
Transcript | F13D11.2a.1 (11) | |||||||
F13D11.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-188 | |||||||
CDS_position | ?-188 | |||||||
Protein_position | ?-63 | |||||||
Intron_number | 1/6 | |||||||
Exon_number | 1-2/7 | |||||||
Interactor | WBInteraction000050612 | |||||||
WBInteraction000500921 | ||||||||
WBInteraction000517970 | ||||||||
WBInteraction000517976 | ||||||||
WBInteraction000517981 | ||||||||
WBInteraction000518177 | ||||||||
Genetics | Interpolated_map_position | X | -4.27069 | |||||
Description | Phenotype | WBPhenotype:0000033 | Paper_evidence | WBPaper00036739 | ||||
Curator_confirmed | WBPerson3490 | |||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00036739 | ||||||
Curator_confirmed | WBPerson3490 | |||||||
WBPhenotype:0000135 | Paper_evidence | WBPaper00036739 | ||||||
Curator_confirmed | WBPerson3490 | |||||||
WBPhenotype:0000167 | Paper_evidence | WBPaper00036739 | ||||||
Curator_confirmed | WBPerson3490 | |||||||
WBPhenotype:0000170 | Paper_evidence | WBPaper00036739 | ||||||
Curator_confirmed | WBPerson3490 | |||||||
WBPhenotype:0000202 | Paper_evidence | WBPaper00035486 | ||||||
Curator_confirmed | WBPerson3490 | |||||||
Phenotype_assay | Genotype | apl-1::gfp::unc-54(3'UTR) | Paper_evidence | WBPaper00035486 | ||||
Curator_confirmed | WBPerson3490 | |||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00040787 | ||||||
Curator_confirmed | WBPerson7245 | |||||||
Remark | Fig 4 and S4, DD neurons mislocalize the presynaptic components UNC-57 endophilin and RAB-3 in the dorsal cord during delayed synapse remodeling. | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | |||||||
WBPhenotype:0002232 | Paper_evidence | WBPaper00040787 | ||||||
Curator_confirmed | WBPerson7245 | |||||||
Remark | Fig 4, DD neurons have delayed synapse remodeling, also Fig S4. | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00037672 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | hbl-1 does not affect lifespan. | Paper_evidence | WBPaper00037672 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000045 | Paper_evidence | WBPaper00040787 | ||||||
Curator_confirmed | WBPerson7245 | |||||||
Remark | Fig S4, overall L1-to-L2 development was not delayed, by the appearance of mlt-10 reporter expression or by the appearance of sister VD/AS cell pairs in the ventral cord | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | |||||||
WBPhenotype:0000566 | Paper_evidence | WBPaper00040787 | ||||||
Curator_confirmed | WBPerson7245 | |||||||
Remark | Fig 3, hbl-1(mg285) mutants alone do not coil during reverse locomotion. | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | |||||||
WBPhenotype:0000656 | Paper_evidence | WBPaper00040787 | ||||||
Curator_confirmed | WBPerson7245 | |||||||
Remark | Fig S3, endogenous EPSC amplitude and rate are normal. | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | |||||||
WBPhenotype:0001320 | Paper_evidence | WBPaper00040787 | ||||||
Curator_confirmed | WBPerson7245 | |||||||
Remark | Fig S3, endogenous IPSC and EPSC amplitude are normal. | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | |||||||
Reference | WBPaper00040787 | |||||||
WBPaper00018447 | ||||||||
WBPaper00037672 | ||||||||
WBPaper00036739 | ||||||||
WBPaper00035486 | ||||||||
Remark | mg285 also contains a C to A point mutation with flanking sequences of ggtccatttggcaattcatcattgacgatg & tgactgcacaacaacccggagaaaagattc giving rise to a L(83)M mutation | Paper_evidence | WBPaper00005909 | |||||
Method | Deletion_allele |