WormBase Tree Display for Variation: WBVar00088310
expand all nodes | collapse all nodes | view schema
| WBVar00088310 | Evidence | Paper_evidence | WBPaper00005250 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ku51 | ||||||
| Other_name (12) | ||||||||
| HGVSg | CHROMOSOME_IV:g.6746027G>C | |||||||
| Sequence_details | SMap | S_parent | Sequence | Y73B6A | ||||
| Flanking_sequences | tttgtccactcgttggagctagattagcaa | aactatttcggcaactgatctatctgggcc | ||||||
| Mapping_target | Y73B6A | |||||||
| Type_of_mutation | Substitution | g | c | Curator_confirmed | WBPerson4055 | |||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00026501 | |||||||
| Laboratory | MH | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00003030 | ||||||
| Transcript | Y73B6A.5c.1 (12) | |||||||
| Y73B6A.5e.1 (12) | ||||||||
| Y73B6A.5f.1 (12) | ||||||||
| Y73B6A.5b.1 (12) | ||||||||
| Y73B6A.5a.1 (12) | ||||||||
| Y73B6A.5d.1 (12) | ||||||||
| Interactor | WBInteraction000006161 | |||||||
| WBInteraction000006162 | ||||||||
| WBInteraction000006163 | ||||||||
| WBInteraction000006164 | ||||||||
| WBInteraction000006165 | ||||||||
| WBInteraction000006166 | ||||||||
| Genetics | Interpolated_map_position | IV | 3.22834 | |||||
| Description | Phenotype_not_observed | WBPhenotype:0000386 | Paper_evidence | WBPaper00035318 | ||||
| Curator_confirmed | WBPerson2987 | |||||||
| Remark | Cobalt-induced germline cell apoptosis was unaffected in lin-45(ku51) mutants (Figure 3) | Paper_evidence | WBPaper00035318 | |||||
| Curator_confirmed | WBPerson2987 | |||||||
| Affected_by | Molecule | WBMol:00003058 | Paper_evidence | WBPaper00035318 | ||||
| Curator_confirmed | WBPerson2987 | |||||||
| Phenotype_assay | Treatment | Synchronized young adult hermaphrodites were treated in K-medium with 0.01 millimolar Cobalt chloride for 12 hours, and apoptotic cells were scored after AO staining. | Paper_evidence | WBPaper00035318 | ||||
| Curator_confirmed | WBPerson2987 | |||||||
| Reference | WBPaper00005250 | |||||||
| WBPaper00035318 | ||||||||
| Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | ||||||
| Method | Substitution_allele |
