WormBase Tree Display for Variation: WBVar00088310
expand all nodes | collapse all nodes | view schema
WBVar00088310 | Evidence | Paper_evidence | WBPaper00005250 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ku51 | ||||||
Other_name (12) | ||||||||
HGVSg | CHROMOSOME_IV:g.6746027G>C | |||||||
Sequence_details | SMap | S_parent | Sequence | Y73B6A | ||||
Flanking_sequences | tttgtccactcgttggagctagattagcaa | aactatttcggcaactgatctatctgggcc | ||||||
Mapping_target | Y73B6A | |||||||
Type_of_mutation | Substitution | g | c | Curator_confirmed | WBPerson4055 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00026501 | |||||||
Laboratory | MH | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003030 | ||||||
Transcript | Y73B6A.5c.1 (12) | |||||||
Y73B6A.5e.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
SIFT | 0.3 | tolerated | ||||||
PolyPhen | 0.141 | benign | ||||||
HGVSc | Y73B6A.5e.1:c.658C>G | |||||||
HGVSp | CE49308:p.Leu220Val | |||||||
cDNA_position | 718 | |||||||
CDS_position | 658 | |||||||
Protein_position | 220 | |||||||
Exon_number | 6/14 | |||||||
Codon_change | Ctt/Gtt | |||||||
Amino_acid_change | L/V | |||||||
Y73B6A.5f.1 (12) | ||||||||
Y73B6A.5b.1 (12) | ||||||||
Y73B6A.5a.1 (12) | ||||||||
Y73B6A.5d.1 (12) | ||||||||
Interactor | WBInteraction000006161 | |||||||
WBInteraction000006162 | ||||||||
WBInteraction000006163 | ||||||||
WBInteraction000006164 | ||||||||
WBInteraction000006165 | ||||||||
WBInteraction000006166 | ||||||||
Genetics | Interpolated_map_position | IV | 3.22834 | |||||
Description | Phenotype_not_observed | WBPhenotype:0000386 | Paper_evidence | WBPaper00035318 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Cobalt-induced germline cell apoptosis was unaffected in lin-45(ku51) mutants (Figure 3) | Paper_evidence | WBPaper00035318 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003058 | Paper_evidence | WBPaper00035318 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Synchronized young adult hermaphrodites were treated in K-medium with 0.01 millimolar Cobalt chloride for 12 hours, and apoptotic cells were scored after AO staining. | Paper_evidence | WBPaper00035318 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00005250 | |||||||
WBPaper00035318 | ||||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | ||||||
Method | Substitution_allele |