WormBase Tree Display for Variation: WBVar00088257
expand all nodes | collapse all nodes | view schema
WBVar00088257 | Evidence | Person_evidence | WBPerson508 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | kn1 | |||||||
Other_name | T07C4.7a.1:c.212G>A | ||||||||
CE50785:p.Gly4Glu | |||||||||
CE00598:p.Gly71Glu | |||||||||
T07C4.7b.1:c.11G>A | |||||||||
HGVSg | CHROMOSOME_III:g.10334600G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T07C4 | |||||
Flanking_sequences | ACCAGCCACAATTGACCTGGATGCTCTCCG | ATTCCATAGAATCAGCGGTTGTGTAATGGC | |||||||
Mapping_target | T07C4 | ||||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson508 | ||||
WBPerson3035 | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00003225 | |||||||
Transcript | T07C4.7b.1 (12) | ||||||||
T07C4.7a.1 (12) | |||||||||
Interactor (12) | |||||||||
Genetics | Interpolated_map_position | III | 2.34584 | ||||||
Mapping_data | In_multi_point | 1752 | |||||||
1753 | |||||||||
1754 | |||||||||
1755 | |||||||||
1756 | |||||||||
1757 | |||||||||
1824 | |||||||||
2407 | |||||||||
Description | Phenotype (24) | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00031688 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000460 | Paper_evidence | WBPaper00031688 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000636 | Paper_evidence | WBPaper00045008 | |||||||
Curator_confirmed | WBPerson298 | ||||||||
Remark | no change in axon degeneration of severed GABA motor neuron axons. | Paper_evidence | WBPaper00045008 | ||||||
Curator_confirmed | WBPerson298 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006976 | PATO:0000460 | Paper_evidence | WBPaper00045008 | ||||
Curator_confirmed | WBPerson298 | ||||||||
WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00045008 | ||||||
Curator_confirmed | WBPerson298 | ||||||||
WBPhenotype:0000686 | Paper_evidence | WBPaper00040524 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mev-1(kn1) mutants showed increased levels of mtROS when compared to wildtype worms. | Paper_evidence | WBPaper00040524 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001871 | Paper_evidence | WBPaper00040161 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The short lived mitochondrial mutant mev-1 was found to be short-lived on 100 uM FUdR plates. | Paper_evidence | WBPaper00040161 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001991 | Paper_evidence | WBPaper00034694 | |||||||
Curator_confirmed | WBPerson2857 | ||||||||
Remark | animals enter into hypoxia-induced reproductive and developmental diapause same as wild-type | Paper_evidence | WBPaper00034694 | ||||||
Curator_confirmed | WBPerson2857 | ||||||||
Reference (34) | |||||||||
Remark | Allele sequenced by James Rand and Ellie Mathews | ||||||||
Method | Substitution_allele |