WormBase Tree Display for Variation: WBVar00088173
expand all nodes | collapse all nodes | view schema
WBVar00088173 | Evidence | Paper_evidence | WBPaper00005913 | |||||
---|---|---|---|---|---|---|---|---|
Accession_evidence | AJ505903 | |||||||
Name | Public_name | ju281 | ||||||
Other_name (17) | ||||||||
HGVSg | CHROMOSOME_I:g.11770391C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK1151 | ||||
Flanking_sequences | ttatgtcgctcgaagaggcggcaaagtatg | acttgttgagcaggatcttccgactgtgct | ||||||
Mapping_target | ZK1151 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005913 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | CZ | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006876 | ||||||
Transcript (11) | ||||||||
Interactor | WBInteraction000558284 | |||||||
Genetics | Interpolated_map_position | I | 9.61494 | |||||
Description | Phenotype | WBPhenotype:0000961 | Paper_evidence | WBPaper00006290 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | VAB-19::GFP remained confined to the regions of epidermal cells overlying muscle but never became localized to attachment structures. | Paper_evidence | WBPaper00006290 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00006290 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00006290 | |||||||
WBPaper00005913 | ||||||||
Method | Substitution_allele |