WormBase Tree Display for Variation: WBVar00088058
expand all nodes | collapse all nodes | view schema
WBVar00088058 | Evidence | Paper_evidence | WBPaper00032244 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | jc36 | |||||||
Other_name | Y57G11C.24j.1:c.465+243_589+1053del | ||||||||
Y57G11C.24d.1:c.414+243_538+1053del | |||||||||
Y57G11C.24n.1:c.633+243_757+1053del | |||||||||
Y57G11C.24i.1:c.630+243_754+1053del | |||||||||
Y57G11C.24o.1:c.633+243_757+1053del | |||||||||
Y57G11C.24g.1:c.630+243_754+1053del | |||||||||
Y57G11C.24h.1:c.630+243_754+1053del | |||||||||
Y57G11C.24a.1:c.465+243_589+1053del | |||||||||
Y57G11C.24k.1:c.414+243_538+1053del | |||||||||
HGVSg | CHROMOSOME_IV:g.14888849_14890386del | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y57G11C | |||||
Flanking_sequences | tgtttcaatatgttattatctaaacattaa | aaagtgaaacggtcacagaagtttgaaaaa | |||||||
Mapping_target | Y57G11C | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005395 | ||||||||
Laboratory | SU | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00050271 | |||||||
WBGene00171425 | |||||||||
WBGene00167744 | |||||||||
WBGene00165917 | |||||||||
WBGene00174402 | |||||||||
WBGene00169931 | |||||||||
WBGene00014594 | |||||||||
WBGene00001330 | |||||||||
WBGene00047720 | |||||||||
WBGene00167979 | |||||||||
Transcript (18) | |||||||||
Interactor | WBInteraction000503805 | ||||||||
Genetics | Interpolated_map_position | IV | 12.5952 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00032244 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals displayed 100% embryonic lethality. Most embryos did not hatch. | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000366 | Paper_evidence | WBPaper00032244 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Embryos showed normal muscle twitching and vigorous movement within the eggshell; however these movements stopped after elongation arrest. | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00032244 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Functional VAB-19::GFP was correctly localized to longitudinal bands in embryos prior to their elongation arrest; however, in later embryos, after arrest, the localization became disorganized and never clearly localized to circumferential stripes. | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005733 | PATO:0000460 | Paper_evidence | WBPaper00032244 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | juIs169 (VAB-19::GFP) | Paper_evidence | WBPaper00032244 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000474 | Paper_evidence | WBPaper00032244 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed defects in muscle attachment. | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001354 | Paper_evidence | WBPaper00032244 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Actin distribution became disorganized by the two-fold stage. After the two-fold stage, intermediate filaments expanded into regions of epidermal cells that were not adjacent to muscle, as observed by MH4 immunostaining. Actin filaments were more randomly oriented or missing from the apical surface of the epidermis. Actin filaments were also disorganized and fragmented in lateral epidermal cells, as observed by phalloidin staining. By the three-fold stage, Myotactin remained in longitudinal bands rather than circumferential stripes as it resided in wild-type animals, as observed by MH46 immunostaining. | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005733 | PATO:0000460 | Paper_evidence | WBPaper00032244 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000020 | PATO:0000460 | Paper_evidence | WBPaper00032244 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001478 | Paper_evidence | WBPaper00032244 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Embryos elongated at a normal rate to the 2.5 to 3-fold stage then stopped elongating ~1hr after the two-fold stage (n=12). | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001521 | Paper_evidence | WBPaper00032244 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Embryos elongated at a normal rate to the 2.5 to 3-fold stage, stopped elongating ~1hr after the two-fold stage then partly retracted (n=12). | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001735 | Paper_evidence | WBPaper00032244 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Embryos showed normal muscle twitching and vigorous movement within the eggshell; however these movements stopped after elongation arrest. | Paper_evidence | WBPaper00032244 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000021 | PATO:0000460 | Paper_evidence | WBPaper00032244 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00032244 | ||||||||
Method | Deletion_allele |