WormBase Tree Display for Variation: WBVar00088024

WBVar00088024 Evidence: Paper_evidence: WBPaper00002189
  Name: Public_name: it51
    Other_name (25)
    HGVSg: CHROMOSOME_V:g.14123121C>T
  Sequence_details: SMap: S_parent: Sequence: H39E23
    Flanking_sequences: agaaattccttgttatcaatccacaaagga atcatcattggataatattatgaaagatcg
    Mapping_target: H39E23
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00002189
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: KK
    Status: Live
  Affects: Gene: WBGene00003916
    Transcript (15)
    Interactor: WBInteraction000501462
      WBInteraction000503508
      WBInteraction000536412
  Genetics: Interpolated_map_position: V 6.15929
  Description: Phenotype: WBPhenotype:0000050 Paper_evidence: WBPaper00032251
        Curator_confirmed: WBPerson2987
        Remark: Table S4 Paper_evidence: WBPaper00032251
            Curator_confirmed: WBPerson2987
        Penetrance: Complete: 100 Paper_evidence: WBPaper00032251
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000961 Paper_evidence: WBPaper00040201
        Curator_confirmed: WBPerson712
        Remark: Dendra::MEX-5 was uniformly low and remained symmetrically distributed rather than forming a gradient. Paper_evidence: WBPaper00040201
            Curator_confirmed: WBPerson712
      WBPhenotype:0001351 Paper_evidence: WBPaper00032251
        Curator_confirmed: WBPerson1751
        Remark: Using a polyclonal antibody specific to phosphoSer458 in MEX-5, authors showed that there is little to no detectable staining with the pSer458 antibody in par-1(it51) and par-4(it47ts), both of which are kinase-dead alleles. The positive control was wild-type embryos (showing asymmetric localization of pSer458), and the negative control was mex-5(zu199), which showed no staining. Paper_evidence: WBPaper00032251
            Curator_confirmed: WBPerson1751
    Phenotype_not_observed: WBPhenotype:0000112 Paper_evidence: WBPaper00040201
        Curator_confirmed: WBPerson712
        Remark: Mutants express full length PAR-1. Paper_evidence: WBPaper00040201
            Curator_confirmed: WBPerson712
      WBPhenotype:0000436 Paper_evidence: WBPaper00040201
        Curator_confirmed: WBPerson712
        Remark: par-1(it51) does not affect PAR-1 or PKC-3 localizations. Paper_evidence: WBPaper00040201
            Curator_confirmed: WBPerson712
  Reference: WBPaper00040201
    WBPaper00032251
    WBPaper00002189
  Method: Substitution_allele