Questions, Feedback & Help

Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Variation: WBVar00088024

expand all nodes | collapse all nodes | view schema

WBVar00088024	Evidence	Paper_evidence	WBPaper00002189
	Name	Public_name	it51
		Other_name	H39E23.1g.1:c.773G>A
			H39E23.1f.1:c.959G>A
			CE46555:p.Arg409Lys
			H39E23.1d.1:c.1034G>A
			H39E23.1e.1:c.1034G>A
			CE44808:p.Arg345Lys
			H39E23.1m.1:c.1523G>A
			CE52350:p.Arg508Lys
			CE48381:p.Arg323Lys
			H39E23.1c.1:c.836G>A
			H39E23.1l.1:c.968G>A
			CE27768:p.Arg361Lys
			H39E23.1j.1:c.1226G>A
			CE45263:p.Arg258Lys
			CE40085:p.Arg279Lys
			H39E23.1a.1:c.1226G>A
			H39E23.1e.6:c.1034G>A
			H39E23.1e.4:c.1034G>A
			CE23838:p.Arg409Lys
			H39E23.1b.1:c.1082G>A
			H39E23.1e.5:c.1034G>A
			CE45159:p.Arg320Lys
			CE44733:p.Arg345Lys
			H39E23.1e.2:c.1034G>A
			H39E23.1e.3:c.1034G>A
		HGVSg	CHROMOSOME_V:g.14123121C>T
	Sequence_details	SMap	S_parent	Sequence	H39E23
		Flanking_sequences	agaaattccttgttatcaatccacaaagga	atcatcattggataatattatgaaagatcg
		Mapping_target	H39E23
		Type_of_mutation	Substitution	g	a	Paper_evidence	WBPaper00002189
		SeqStatus	Sequenced
	Variation_type	Allele
	Origin	Species	Caenorhabditis elegans
		Laboratory	KK
		Status	Live
	Affects	Gene	WBGene00003916
		Transcript	H39E23.1e.3	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious_low_confidence
				PolyPhen	0.522	possibly_damaging
				HGVSc	H39E23.1e.3:c.1034G>A
				HGVSp	CE44733:p.Arg345Lys
				cDNA_position	1034
				CDS_position	1034
				Protein_position	345
				Exon_number	3/12
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1e.2	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious_low_confidence
				PolyPhen	0.522	possibly_damaging
				HGVSc	H39E23.1e.2:c.1034G>A
				HGVSp	CE44733:p.Arg345Lys
				cDNA_position	1034
				CDS_position	1034
				Protein_position	345
				Exon_number	3/15
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1g.1	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious
				PolyPhen	0.271	benign
				HGVSc	H39E23.1g.1:c.773G>A
				HGVSp	CE45263:p.Arg258Lys
				cDNA_position	773
				CDS_position	773
				Protein_position	258
				Exon_number	2/12
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1a.1	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious
				PolyPhen	0.271	benign
				HGVSc	H39E23.1a.1:c.1226G>A
				HGVSp	CE23838:p.Arg409Lys
				cDNA_position	1226
				CDS_position	1226
				Protein_position	409
				Exon_number	6/17
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1d.1	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious
				PolyPhen	0	unknown
				HGVSc	H39E23.1d.1:c.1034G>A
				HGVSp	CE44808:p.Arg345Lys
				cDNA_position	1034
				CDS_position	1034
				Protein_position	345
				Exon_number	3/15
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1l.1	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious
				PolyPhen	0.271	benign
				HGVSc	H39E23.1l.1:c.968G>A
				HGVSp	CE48381:p.Arg323Lys
				cDNA_position	1235
				CDS_position	968
				Protein_position	323
				Exon_number	4/15
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1e.4	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious_low_confidence
				PolyPhen	0.522	possibly_damaging
				HGVSc	H39E23.1e.4:c.1034G>A
				HGVSp	CE44733:p.Arg345Lys
				cDNA_position	1034
				CDS_position	1034
				Protein_position	345
				Exon_number	3/13
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1e.1	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious_low_confidence
				PolyPhen	0.522	possibly_damaging
				HGVSc	H39E23.1e.1:c.1034G>A
				HGVSp	CE44733:p.Arg345Lys
				cDNA_position	1034
				CDS_position	1034
				Protein_position	345
				Exon_number	3/16
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1c.1	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious
				PolyPhen	0.271	benign
				HGVSc	H39E23.1c.1:c.836G>A
				HGVSp	CE40085:p.Arg279Lys
				cDNA_position	836
				CDS_position	836
				Protein_position	279
				Exon_number	3/13
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1m.1	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious_low_confidence
				PolyPhen	0.271	benign
				HGVSc	H39E23.1m.1:c.1523G>A
				HGVSp	CE52350:p.Arg508Lys
				cDNA_position	1523
				CDS_position	1523
				Protein_position	508
				Exon_number	6/19
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1j.1	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious
				PolyPhen	0.98	probably_damaging
				HGVSc	H39E23.1j.1:c.1226G>A
				HGVSp	CE46555:p.Arg409Lys
				cDNA_position	1226
				CDS_position	1226
				Protein_position	409
				Exon_number	6/17
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1f.1	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious
				PolyPhen	0.271	benign
				HGVSc	H39E23.1f.1:c.959G>A
				HGVSp	CE45159:p.Arg320Lys
				cDNA_position	959
				CDS_position	959
				Protein_position	320
				Exon_number	3/13
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1e.5	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious_low_confidence
				PolyPhen	0.522	possibly_damaging
				HGVSc	H39E23.1e.5:c.1034G>A
				HGVSp	CE44733:p.Arg345Lys
				cDNA_position	1034
				CDS_position	1034
				Protein_position	345
				Exon_number	3/12
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1b.1	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious
				PolyPhen	0.271	benign
				HGVSc	H39E23.1b.1:c.1082G>A
				HGVSp	CE27768:p.Arg361Lys
				cDNA_position	1098
				CDS_position	1082
				Protein_position	361
				Exon_number	5/15
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
			H39E23.1e.6	VEP_consequence	missense_variant
				VEP_impact	MODERATE
				SIFT	0	deleterious_low_confidence
				PolyPhen	0.522	possibly_damaging
				HGVSc	H39E23.1e.6:c.1034G>A
				HGVSp	CE44733:p.Arg345Lys
				cDNA_position	1034
				CDS_position	1034
				Protein_position	345
				Exon_number	3/12
				Codon_change	aGa/aAa
				Amino_acid_change	R/K
		Interactor	WBInteraction000501462
			WBInteraction000503508
			WBInteraction000536412
	Genetics	Interpolated_map_position	V	6.15929
	Description	Phenotype	WBPhenotype:0000050	Paper_evidence	WBPaper00032251
				Curator_confirmed	WBPerson2987
				Remark	Table S4	Paper_evidence	WBPaper00032251
						Curator_confirmed	WBPerson2987
				Penetrance	Complete	100	Paper_evidence	WBPaper00032251
							Curator_confirmed	WBPerson2987
			WBPhenotype:0000961	Paper_evidence	WBPaper00040201
				Curator_confirmed	WBPerson712
				Remark	Dendra::MEX-5 was uniformly low and remained symmetrically distributed rather than forming a gradient.	Paper_evidence	WBPaper00040201
						Curator_confirmed	WBPerson712
			WBPhenotype:0001351	Paper_evidence	WBPaper00032251
				Curator_confirmed	WBPerson1751
				Remark	Using a polyclonal antibody specific to phosphoSer458 in MEX-5, authors showed that there is little to no detectable staining with the pSer458 antibody in par-1(it51) and par-4(it47ts), both of which are kinase-dead alleles. The positive control was wild-type embryos (showing asymmetric localization of pSer458), and the negative control was mex-5(zu199), which showed no staining.	Paper_evidence	WBPaper00032251
						Curator_confirmed	WBPerson1751
		Phenotype_not_observed	WBPhenotype:0000112	Paper_evidence	WBPaper00040201
				Curator_confirmed	WBPerson712
				Remark	Mutants express full length PAR-1.	Paper_evidence	WBPaper00040201
						Curator_confirmed	WBPerson712
			WBPhenotype:0000436	Paper_evidence	WBPaper00040201
				Curator_confirmed	WBPerson712
				Remark	par-1(it51) does not affect PAR-1 or PKC-3 localizations.	Paper_evidence	WBPaper00040201
						Curator_confirmed	WBPerson712
	Reference	WBPaper00040201
		WBPaper00032251
		WBPaper00002189
	Method	Substitution_allele