WormBase Tree Display for Variation: WBVar00088023
expand all nodes | collapse all nodes | view schema
WBVar00088023 | Evidence | Paper_evidence | WBPaper00003944 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | it47 | |||||||
Other_name | Y59A8B.14c.1:c.857T>G | ||||||||
Y59A8B.14b.1:c.446T>G | |||||||||
CE46081:p.Ile286Ser | |||||||||
CE46046:p.Ile149Ser | |||||||||
CE27410:p.Ile290Ser | |||||||||
Y59A8B.14a.1:c.869T>G | |||||||||
HGVSg | CHROMOSOME_V:g.18103199T>G | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | |||||
Flanking_sequences | gacgtctaaccatcggagaatctcatgcaa | ttttattgaactctgtcagggactcaatta | |||||||
Mapping_target | Y59A8B | ||||||||
Type_of_mutation | Substitution | t | g | Paper_evidence | WBPaper00003944 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00023550 | ||||||||
Laboratory | KK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003919 | |||||||
Transcript (3) | |||||||||
Interactor | WBInteraction000500368 | ||||||||
WBInteraction000500370 | |||||||||
WBInteraction000500372 | |||||||||
WBInteraction000503511 | |||||||||
WBInteraction000504538 | |||||||||
WBInteraction000517300 | |||||||||
WBInteraction000536413 | |||||||||
Genetics | Interpolated_map_position | V | 14.1033 | ||||||
Description | Phenotype (24) | ||||||||
Phenotype_not_observed | WBPhenotype:0000034 | Paper_evidence | WBPaper00038098 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No obvious modifications were observed in the organization of the myosin network: the number and the area of NMY-2::GFP foci in par-4 mutants were identical to wild-type embryos during the polarization phase. | Paper_evidence | WBPaper00038098 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000417 | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001018 | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001885 | Paper_evidence | WBPaper00038098 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The initiation of ingression was similar between wild-type and par-4 mutant embryos during the first minute following ring formation. | Paper_evidence | WBPaper00038098 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002005 | Paper_evidence | WBPaper00038098 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No difference was observed in the cortical tension of the actomyosin network from controls. | Paper_evidence | WBPaper00038098 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:3852 | |||||||
Models_disease_in_annotation | WBDOannot00000892 | ||||||||
Reference (11) | |||||||||
Method | Substitution_allele |