WormBase Tree Display for Variation: WBVar00088013
expand all nodes | collapse all nodes | view schema
WBVar00088013 | Evidence | Paper_evidence | WBPaper00003944 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | it33 | |||||||
Other_name | Y59A8B.14c.1:c.563G>A | ||||||||
Y59A8B.14b.1:c.152G>A | |||||||||
CE46081:p.Gly188Glu | |||||||||
Y59A8B.14a.1:c.575G>A | |||||||||
CE27410:p.Gly192Glu | |||||||||
CE46046:p.Gly51Glu | |||||||||
HGVSg | CHROMOSOME_V:g.18101792G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | |||||
Flanking_sequences | gatacatgtggggaggacaaattggtacag | atcatatggaaaagtgaaagaatgtattga | |||||||
Mapping_target | Y59A8B | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003944 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00003932 | ||||||||
Laboratory | KK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003919 | |||||||
Transcript | Y59A8B.14a.1 (12) | ||||||||
Y59A8B.14b.1 (12) | |||||||||
Y59A8B.14c.1 (12) | |||||||||
Interactor | WBInteraction000501668 | ||||||||
Genetics | Interpolated_map_position | V | 14.0938 | ||||||
Mapping_data | In_2_point | 3386 | |||||||
In_multi_point | 1167 | ||||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00032251 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S4 | Paper_evidence | WBPaper00032251 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Complete | 100 | Paper_evidence | WBPaper00032251 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000052 | Paper_evidence | WBPaper00001032 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | nonconditional, fully penetrant Mel; putative null | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | 100 percent | Paper_evidence | WBPaper00001032 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16C, 20C, 25C | Paper_evidence | WBPaper00001032 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001106 | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The rotation of the P1 spindle complex is disrupted and P1 blastomere sometimes divides transversely rather than longitudinally | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 20 percent | Paper_evidence | WBPaper00001032 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Staining with anti-tubulin antibody | Paper_evidence | WBPaper00001032 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001120 | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In contrast to the wild-type division sequence, early blastomeres cleave synchronously up until the fourth or fifth cleavage | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001637 | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Almost no terminal stage par-4 embryos produce any intestinal cells | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | 100 percent | Paper_evidence | WBPaper00001032 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001032 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001642 | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The orientation of the second embryonic cleavage is altered | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Staining with anti-tubulin antibody | Paper_evidence | WBPaper00001032 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000417 | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000748 | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | AB and P1 blastomeres in par-4 mutants have the wild-type pattern of size differences | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001018 | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001032 | ||||||||
WBPaper00016483 | |||||||||
WBPaper00020804 | |||||||||
WBPaper00013870 | |||||||||
WBPaper00001516 | |||||||||
WBPaper00032251 | |||||||||
Method | Substitution_allele |