WormBase Tree Display for Variation: WBVar00087892
expand all nodes | collapse all nodes | view schema
| WBVar00087892 | Evidence | Paper_evidence | WBPaper00035972 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | hj13 | |||||
| Other_name | E04F6.3.1:c.556G>A | ||||||
| CE01215:p.Asp186Asn | |||||||
| HGVSg | CHROMOSOME_II:g.7196987G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | E04F6 | |||
| Flanking_sequences | caagctgctctttatcgtttgggatcagga | atatgaatcctcttcacgttgatccagagt | |||||
| Mapping_target | E04F6 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00035972 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00040194 | ||||||
| Laboratory | VS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00017123 | |||||
| Transcript | E04F6.3.1 (12) | ||||||
| Genetics | Interpolated_map_position | II | 0.498765 | ||||
| Description | Phenotype | WBPhenotype:0000138 | Paper_evidence | WBPaper00035972 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | maoc-1 mutants had higher levels of TAG than wildtype animals | Paper_evidence | WBPaper00035972 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0001888 | Paper_evidence | WBPaper00035972 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Mutant animals show intense staining of C1-BODIPY-C12 that accumulates in enlarged spherical intracellular structures. Oil-Red-O staining confirmed that the enlarged spherical intracellular structures in the mutant intestine are sites of fat storage (lipid droplets) | Paper_evidence | WBPaper00035972 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0002051 | Paper_evidence | WBPaper00040624 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | In contrast to wild-type and acox-1(ok2257) worms, short-chain ascarosides were not detected in mutant worms, which instead accumulate several series of (omega-1)- and omega-oxygenated medium- and long-chain ascarosides. | Paper_evidence | WBPaper00040624 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Disease_info | Models_disease | DOID:9970 | |||||
| Models_disease_in_annotation | WBDOannot00000569 | ||||||
| Reference | WBPaper00040624 | ||||||
| WBPaper00035972 | |||||||
| Method | Substitution_allele |
