WormBase Tree Display for Variation: WBVar00087892
expand all nodes | collapse all nodes | view schema
WBVar00087892 | Evidence | Paper_evidence | WBPaper00035972 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | hj13 | |||||
Other_name | E04F6.3.1:c.556G>A | ||||||
CE01215:p.Asp186Asn | |||||||
HGVSg | CHROMOSOME_II:g.7196987G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | E04F6 | |||
Flanking_sequences | caagctgctctttatcgtttgggatcagga | atatgaatcctcttcacgttgatccagagt | |||||
Mapping_target | E04F6 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00035972 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00040194 | ||||||
Laboratory | VS | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00017123 | |||||
Transcript | E04F6.3.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
SIFT | 0 | deleterious | |||||
PolyPhen | 1 | probably_damaging | |||||
HGVSc | E04F6.3.1:c.556G>A | ||||||
HGVSp | CE01215:p.Asp186Asn | ||||||
cDNA_position | 618 | ||||||
CDS_position | 556 | ||||||
Protein_position | 186 | ||||||
Exon_number | 4/6 | ||||||
Codon_change | Gat/Aat | ||||||
Amino_acid_change | D/N | ||||||
Genetics | Interpolated_map_position | II | 0.498765 | ||||
Description | Phenotype | WBPhenotype:0000138 | Paper_evidence | WBPaper00035972 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | maoc-1 mutants had higher levels of TAG than wildtype animals | Paper_evidence | WBPaper00035972 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001888 | Paper_evidence | WBPaper00035972 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Mutant animals show intense staining of C1-BODIPY-C12 that accumulates in enlarged spherical intracellular structures. Oil-Red-O staining confirmed that the enlarged spherical intracellular structures in the mutant intestine are sites of fat storage (lipid droplets) | Paper_evidence | WBPaper00035972 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0002051 | Paper_evidence | WBPaper00040624 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | In contrast to wild-type and acox-1(ok2257) worms, short-chain ascarosides were not detected in mutant worms, which instead accumulate several series of (omega-1)- and omega-oxygenated medium- and long-chain ascarosides. | Paper_evidence | WBPaper00040624 | ||||
Curator_confirmed | WBPerson712 | ||||||
Disease_info | Models_disease | DOID:9970 | |||||
Models_disease_in_annotation | WBDOannot00000569 | ||||||
Reference | WBPaper00040624 | ||||||
WBPaper00035972 | |||||||
Method | Substitution_allele |