WormBase Tree Display for Variation: WBVar00087744
expand all nodes | collapse all nodes | view schema
WBVar00087744 | Evidence | Paper_evidence | WBPaper00044616 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | hc3 | |||||
Other_name | CE32072:p.Ser69Pro | ||||||
W09B6.3a.1:c.205T>C | |||||||
HGVSg | CHROMOSOME_II:g.1123959T>C | ||||||
Sequence_details | SMap | S_parent | Sequence | W09B6 | |||
Flanking_sequences | tttcaggattccggcattcattttatcttc | caaaagccacgtgtatacaatatccgtcaa | |||||
Mapping_target | W09B6 | ||||||
Type_of_mutation | Substitution | t | c | Paper_evidence | WBPaper00044616 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00000359 | ||||||
Laboratory | BA | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00021103 | |||||
Transcript | W09B6.3a.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
HGVSc | W09B6.3a.1:c.205T>C | ||||||
HGVSp | CE32072:p.Ser69Pro | ||||||
cDNA_position | 207 | ||||||
CDS_position | 205 | ||||||
Protein_position | 69 | ||||||
Exon_number | 4/13 | ||||||
Codon_change | Tca/Cca | ||||||
Amino_acid_change | S/P | ||||||
Genetics | Interpolated_map_position | II | -15.5661 | ||||
Mapping_data | In_multi_point | 199 | |||||
Description | Phenotype (11) | ||||||
Phenotype_not_observed | WBPhenotype:0000033 | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals grow and develop at the same rate as wild type, initiating egg laying at 45 hr post-hatching, as do N2 hermaphrodites. | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000186 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Oocytes are produced and are capable of being fertilized. | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000284 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Sperm were transferred during copulation. | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000670 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | At the start of their egg-laying period, 45 hr post-hatching at 25 deg C, the spermathecae of these hermaphrodites contain over 170 sperm. | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000676 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals grow and develop at the same rate as wild type, initiating egg laying at 45 hr post-hatching, as do N2 hermaphrodites. | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00001075 | ||||||
WBPaper00000495 | |||||||
WBPaper00015949 | |||||||
WBPaper00044616 | |||||||
Method | Substitution_allele |