WormBase Tree Display for Variation: WBVar00087744
expand all nodes | collapse all nodes | view schema
WBVar00087744 | Evidence | Paper_evidence | WBPaper00044616 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | hc3 | |||||||
Other_name | CE32072:p.Ser69Pro | ||||||||
W09B6.3a.1:c.205T>C | |||||||||
HGVSg | CHROMOSOME_II:g.1123959T>C | ||||||||
Sequence_details | SMap | S_parent | Sequence | W09B6 | |||||
Flanking_sequences | tttcaggattccggcattcattttatcttc | caaaagccacgtgtatacaatatccgtcaa | |||||||
Mapping_target | W09B6 | ||||||||
Type_of_mutation | Substitution | t | c | Paper_evidence | WBPaper00044616 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000359 | ||||||||
Laboratory | BA | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00021103 | |||||||
Transcript | W09B6.3a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | W09B6.3a.1:c.205T>C | ||||||||
HGVSp | CE32072:p.Ser69Pro | ||||||||
cDNA_position | 207 | ||||||||
CDS_position | 205 | ||||||||
Protein_position | 69 | ||||||||
Exon_number | 4/13 | ||||||||
Codon_change | Tca/Cca | ||||||||
Amino_acid_change | S/P | ||||||||
Genetics | Interpolated_map_position | II | -15.5661 | ||||||
Mapping_data | In_multi_point | 199 | |||||||
Description | Phenotype | WBPhenotype:0000357 | Paper_evidence | WBPaper00001075 | |||||
WBPaper00000495 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | At the permissive temperature, ts mutants produced 100 to 300 progeny and less than 65 unfertilized eggs, which were laid late in the life cycle, like those of wild-type hermaphrodites. At the restrictive temperature of 25 deg C, animals produced only a few progeny and laid 72 to 282 unfertilized eggs. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001075 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00001075 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
25 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000387 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | hermaphrodites and males grown at 25C produce nonfunctional nonmotile sperm with some aberrant pseudopods perinuclear tubules. TSP L3- L4. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | At the permissive temperature, ts mutants produced 100 to 300 progeny and less than 65 unfertilized eggs, which were laid late in the life cycle, like those of wild-type hermaphrodites. At the restrictive temperature of 25 deg C, animals produced only a few progeny and laid 72 to 282 unfertilized eggs. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000693 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000806 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are fertilization defective. Animals have a long (24 hr) temperature sensitive period (TSP). | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000863 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are ts sterile, producing less progeny at restrictive temperatures. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Mating of fertile dpy-11 hermaphrodites with sterile fer males or with permissively grown males did not reduce hermaphrodite self-fertilization, whereas mating with wild-type males did. | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000983 | Paper_evidence | WBPaper00044616 | |||||||
Curator_confirmed | WBPerson602 | ||||||||
Remark | fer-3(hc3) fails to complement the Fer and Eri phenotypes of eri-3(tm1361). | Paper_evidence | WBPaper00044616 | ||||||
Curator_confirmed | WBPerson602 | ||||||||
WBPhenotype:0001258 | Paper_evidence | WBPaper00044616 | |||||||
Curator_confirmed | WBPerson602 | ||||||||
Remark | fer-3(hc3) fails to complement the Fer and Eri phenotypes of eri-3(tm1361). | Paper_evidence | WBPaper00044616 | ||||||
Curator_confirmed | WBPerson602 | ||||||||
WBPhenotype:0001360 | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001075 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001075 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00001075 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001386 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Self-fertility = 1% (25C) 60% (16C). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001720 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Nonfunctional sperm of fer hermaphrodites are progressively lost fro the spermathecae of mutant hermaphrodites. by the time 40-70 oocytes have passed through the spermathecae of sterile hermaphrodites, most of the sperm have been swept out rather than migrating back through the spermathecal valve. fer-3 mutants lose sperm at a faster rate than other fer mutants. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000033 | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals grow and develop at the same rate as wild type, initiating egg laying at 45 hr post-hatching, as do N2 hermaphrodites. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000186 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Oocytes are produced and are capable of being fertilized. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000284 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Sperm were transferred during copulation. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000670 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | At the start of their egg-laying period, 45 hr post-hatching at 25 deg C, the spermathecae of these hermaphrodites contain over 170 sperm. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000676 | Paper_evidence | WBPaper00000495 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals grow and develop at the same rate as wild type, initiating egg laying at 45 hr post-hatching, as do N2 hermaphrodites. | Paper_evidence | WBPaper00000495 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00001075 | ||||||||
WBPaper00000495 | |||||||||
WBPaper00015949 | |||||||||
WBPaper00044616 | |||||||||
Method | Substitution_allele |